UniGene Name: sp_v1.1_unigene79405
Length:
245 nt
Origin of reads:
>sp_v1.1_unigene79405
CGTCGTGACCTTGGCTGTCACTCATCTCCAACATGCTACAACGTCGTGACCTTGGCTGTCACTCATCTTCCCATGAATTCCAATATCTGTTTCCAGAATGTGGTTTTCTTGCGTCACTCAACCACCCCTTTTAGTGGCAGTACCCTTAAGGCTCCAGTGCAGAATACAGCATTCAACCCAATTTCCCCCTCACAGACAAATTGCAATTCAACAGAGTTAATTTCAGGATTGCACGATGATTTCAG |
If you push the Download ace button, you will download an ace file of this UniGene.
To watch this ACE file you will need an ACE viewer program as Tablet:
Go to the Tablet ACE viewer Web
Fln status:
unknown
Fln database:
testcode
Fln subject:
Fln msg:
Test code:
0
Test Code was used to find complete genes when there was not found a reliable orthologue.
The best ORF (Open Reading Frame) is shown, and only ORFs > 200pb were analyzed.
Your ORF will be more reliable if a stop codon was found before the start codon.
A Test Code value > 0.95 means the ORF is probably coding.
A Test Code value < 0.74 means the ORF is probably non-coding.
Test Code values in between 0.74 and 0.95 mean it is uncertain whether the ORF is coding or not.
| Position |
A % |
C % |
G % |
T % |
Probability |
| 44 |
|
33 |
|
66 |
0.997471 |
| 49 |
66 |
|
|
33 |
0.997471 |
| 53 |
|
33 |
|
66 |
0.997454 |
| 54 |
|
33 |
66 |
|
0.997454 |
| 99 |
|
50 |
|
50 |
1.0 |
| 100 |
50 |
|
50 |
|
1.0 |
| 102 |
|
50 |
50 |
|
1.0 |
| 104 |
50 |
|
|
50 |
1.0 |
| 105 |
|
|
50 |
50 |
1.0 |
| 106 |
50 |
|
|
50 |
1.0 |
| 107 |
|
50 |
|
50 |
1.0 |
| 115 |
50 |
|
50 |
|
1.0 |
| 116 |
50 |
|
|
50 |
1.0 |
| 117 |
50 |
50 |
|
|
1.0 |
Back
UniGene Fasta
