UniGene Name: sp_v3.0_unigene194186
Length: 78 nt
If you push the Download ace button, you will download an ace file of this UniGene. To watch this ACE file you will need an ACE viewer program as Tablet: Go to the Tablet ACE viewer Web
Fln status: Internal
Fln database: tr_plants
Fln subject: B9SQW7
Fln msg: Distance to subject end: 1544 aas, your sequence is shorter than subject: 26 - 1888
Fln protein: VPPVAADSPSVFPPLPVEDETWDGNG Protein Length: 27
Fln nts: GTCCCACCAGTAGCTGCTGATTCACCATCTGTCTTCCCACCTCTACCAGTAGAGGATGAAACCTGGGATGGCAATGGT
Fln Alignment:
AllPine_b_c32836___VPPVAADSPSVFPPLPVEDETWDGNGB9SQW7________________VPPVVADNPSVFPPLPVEDENWGGNG
Biología Molecular y Biotecnología de Plantas, Facultad de Ciencias y Plataforma Andaluza de Bioinformática, Universidad de Málaga, E-29071 Málaga, Spain