UniGene Name: sp_v3.0_unigene165142
Length: 71 nt
If you push the Download ace button, you will download an ace file of this UniGene. To watch this ACE file you will need an ACE viewer program as Tablet: Go to the Tablet ACE viewer Web
Fln status: Internal
Fln database: coniferopsida.fasta
Fln subject: C0PT31
Fln msg: Distance to subject end: 126 aas, your sequence is shorter than subject: 23 - 924
Fln protein: QHAALNFGQYPYGGYVPNRTLYY Protein Length: 24
Fln nts: CAGCATGCTGCTTTGAATTTTGGACAATACCCATATGGAGGGTATGTACCCAACAGAACCCTGTATTATGA
Fln Alignment:
HA8LWWM01CRBEA___QHAALNFGQYPYGGYVPNRC0PT31________________QHAALNFGQYPYGGYVPNR
Biología Molecular y Biotecnología de Plantas, Facultad de Ciencias y Plataforma Andaluza de Bioinformática, Universidad de Málaga, E-29071 Málaga, Spain