UniGene Name: sp_v3.0_unigene150481
Length: 113 nt
If you push the Download ace button, you will download an ace file of this UniGene. To watch this ACE file you will need an ACE viewer program as Tablet: Go to the Tablet ACE viewer Web
Fln status: C-terminus
Fln database: tr_plants
Fln subject: F2E5N1
Fln msg: your sequence is shorter than subject: 26 - 91
Fln protein: FPHKDDFIEQVSPRRQYKTHATVLK* Protein Length: 27
Fln nts: TTCCCGCACAAGGATGACTTCATCGAGCAGGTGTCGCCGCGGAGGCAGTACAAGACGCACGCCACCGTCCTCAAGTGA___GACGGCGCACTCTCCGCGTGAGTGGCGCGATGTAA
Fln Alignment:
HLKU4M004ICOUM___FPHKDDFIEQVSPRRQYKTHATVLKF2E5N1________________FPHKDDFIEQVSPRRQYKTHATVLK
Biología Molecular y Biotecnología de Plantas, Facultad de Ciencias y Plataforma Andaluza de Bioinformática, Universidad de Málaga, E-29071 Málaga, Spain