UniGene Name: sp_v3.0_unigene148955
Length: 75 nt
If you push the Download ace button, you will download an ace file of this UniGene. To watch this ACE file you will need an ACE viewer program as Tablet: Go to the Tablet ACE viewer Web
Fln status: Internal
Fln database: coniferopsida.fasta
Fln subject: D7GLD4
Fln msg: Distance to subject end: 57 aas, your sequence is shorter than subject: 25 - 534
Fln protein: SHTQEETLPIYLTTDSKSQDLGSSE Protein Length: 26
Fln nts: AGCCACACGCAAGAGGAGACACTGCCAATATATCTTACAACAGACTCCAAGTCTCAAGATCTAGGATCTAGTGAG
Fln Alignment:
HIF1XHV02D5AQQ___SHTQEETLPIYLTTDSKSQDLGSSED7GLD4________________SHTQEETLPIYLTTDSKSQDLVSSE
Biología Molecular y Biotecnología de Plantas, Facultad de Ciencias y Plataforma Andaluza de Bioinformática, Universidad de Málaga, E-29071 Málaga, Spain