SustainPineDB

All assemblies
Assembly info
Unigenes
SNPs
SSRs
Descriptions
GOs
ECs
KEGGs
InterPros
miRNAs

Assembly Name: SustainPine v3.0

UniGene Name: sp_v3.0_unigene145074

Length: 244 nt

UniGene Fasta

>sp_v3.0_unigene145074
ATATGCAAAAGTGTTGCCAGCTGTGAACCAGGTTGAATGCCATCCAATGTGGCAGCAACATAATCTTCGTGAATTCTGCAAGTCCCAGCATATTCATCTCTCTGCATACTCTCCTCTGGGTTCTCCAGGTAGTGGATGGATTAAAGTGAAAATGTTAGAGCACCCTATACTAAAGTGGCAGAGAAGTTGGGCAAGACACCTGCACAGGTTGCACTTCGCTGGGGTTTACAAACTGGCAATAGTG

Ace file of the UniGene sp_v3.0_unigene145074

If you push the Download ace button, you will download an ace file of this UniGene.

To watch this ACE file you will need an ACE viewer program as Tablet:

Go to the Tablet ACE viewer Web

Annotations

Source	Descriptions	Term	Type	e value	Identity
AutoFact	Aldo/keto reductase (Fragment) n=1 Tax=Malus x domestica RepID=Q6V8S4_MALDO	-	-	9.0e-24	67%
FL-Next	tr=Putative uncharacterized protein; Picea sitchensis (Sitka spruce) (Pinus sitchensis).	-	-	0.0	87%
Sma3	Aldo-keto reductase	-	-	1.34e-15	-

Source	ECs	Term	Type	e value	Identity
Sma3	Aldehyde reductase.	EC:1.1.1.21	-	4.42e-14	-

Source	KEGGs	Term	e value	Identity
Sma3	Pentose and glucuronate interconversions	00040	4.42e-14	%
Sma3	Fructose and mannose metabolism	00051	4.42e-14	%
Sma3	Galactose metabolism	00052	4.42e-14	%
Sma3	Glycerolipid metabolism	00561	4.42e-14	%
Sma3	Pyruvate metabolism	00620	4.42e-14	%
Sma3	Metabolic pathways	01100	4.42e-14	%

Source	Gene names
Sma3	At2g37760; At2g37770; At2g37790; At3g53880; F5K20_180; GSVIVT00021380001; GSVIVT00021381001; GSVIVT00021382001; GSVIVT00021383001; GSVIVT00030670001; OJ1651_D06.16; Os01g0847700; Os05g0456200; Os05g0456300; OsI_04428; OsI_20196; OsI_20197; OsJ_18785; OsJ_

Source	GOs	Term	Type	Identity
Sma3	oxidoreductase activity	GO:0016491	Molecular Function	-
Sma3	response to cadmium ion	GO:0046686	Biological Process	-
Sma3	oxidation-reduction process	GO:0055114	Biological Process	-

Source	InterPros	Term	Type	Identity
Sma3	Aldo/keto reductase	IPR001395	-	-
Sma3	ABC transporter, conserved site	IPR017871	-	-
Sma3	Aldo/keto reductase, conserved site	IPR018170	-	-

Source	Species	ID	Description	e value	Identity
ATG	Arabidoptis thaliana	AT2G37770.2	NAD(P)-linked oxidoreductase superfamily protein chr2:15834888-15836659 FORWARD LENGTH=315	8.0e-26	67%
RefSeq	Arabidopsis thaliana	NP_001031505.1	NAD(P)-linked oxidoreductase-like protein [Arabidopsis thaliana]	1.0e-25	67%
RefSeq	Populus trichocarpa	XP_002323797.1	predicted protein [Populus trichocarpa]	5.0e-24	63%

Full-Lengther Next Prediction

Fln status: Internal

Fln database: coniferopsida.fasta

Fln subject: A9NS31

Fln msg: ERROR#3, very serious frame error, Overlapping hits, possible frame ERROR between 175 and 22, Distance to subject end: 63 aas, your sequence is shorter than subject: 81 - 303

Fln protein: YAKVLPxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAEKLGKTPAQVALRWGLQTGNS

Protein Length: 82

Fln nts: ATATGCAAAAGTGTTGCCAxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxGCAGAGAAGTTGGGCAAGACACCTGCACAGGTTGCACTTCGCTGGGGTTTACAAACTGGCAATAGTG

Fln Alignment:

AllPine_a_rep_c116554___YAKVLPAVNQVExxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAPYTK-VAEKLGKTPAQVALRWGLQTGNS
A9NS31________________YAKVLPAVNQVExxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxHPILKQVAEKLGKTPAQVALRWGLQSGNS

Back

Biología Molecular y Biotecnología de Plantas, Facultad de Ciencias y Plataforma Andaluza de Bioinformática, Universidad de Málaga, E-29071 Málaga, Spain