SustainPineDB

All assemblies
Assembly info
Unigenes
SNPs
SSRs
Descriptions
GOs
ECs
KEGGs
InterPros
miRNAs

Assembly Name: SustainPine v3.0

UniGene Name: sp_v3.0_unigene143228

Length: 534 nt

UniGene Fasta

>sp_v3.0_unigene143228
ACTGACGAAGAACTTATATCCTGCTATCTCAAGGGCAAACTCAATCATGGCCTTAAAGAAGCAGAGATCGAGGTTATTAGCGAGGTCGACCTCTACAGAAACGAGCCCTGGGATTTGCCTGAGAAATCCTTCCTGCCCCGTGGTGATTTGGTGTGGTATTTCTTTAGTCCTTGTGACAGGAAGTATCCGAATGGTTCACGCACTAATAGGGCTACTGAAGCTGGGTATTGGAAAGCCACAGGAAGGGATCGTAAAGTTTACTCTCGAGCAAACACAGTAGGAATAAAAAAGACTCTAGTTTTCTATAGAGGCCGGGCTCCACAAGGTGAACGAACTGATTGGATAATGCATGAATATCGTCTTGAGGAAAATGAATGTGAGGCAGGACCTTGTTTGCAGGTATTATTTATGAATTATTCATTCTTTGGGATGCTGTTTTGGGATGCTGTTTTTAAGTGAAATGTTTTTGTTTGGATACCATCATTATTGAAAACACCATCCATATTCATATTCATAGATAGATACATACACCTC

Ace file of the UniGene sp_v3.0_unigene143228

If you push the Download ace button, you will download an ace file of this UniGene.

To watch this ACE file you will need an ACE viewer program as Tablet:

Go to the Tablet ACE viewer Web

Annotations

Source	Descriptions	Term	Type	Identity
AutoFact	NAC protein n=2 Tax=Oryza sativa RepID=Q8H045_ORYSJ	-	-	72%
FL-Next	tr=Putative uncharacterized protein; Picea sitchensis (Sitka spruce) (Pinus sitchensis).	-	-	84%
Sma3	NAC domain protein, IPR003441	-	-	-

Source	Gene names
Sma3	131L1.6; 134P10.2; AT4g10350; AT4g17980; AT4g35580; AT4g36160; At1g12260; At1g32510; At1g33060; At1g33280; At1g34180; At1g34190; At1g54330; At1g65910; At1g69490; At1g71930; At1g76420; At2g18060; At2g46770; At3g03200; At3g10480; At3g10500; At3g17730; At3g2

Source	GOs	Term	Type	Identity
Sma3	nucleus	GO:0005634	Cellular Component	-
Sma3	DNA binding	GO:0003677	Molecular Function	-
Sma3	sequence-specific DNA binding transcription factor activity	GO:0003700	Molecular Function	-
Sma3	transcription coactivator activity	GO:0003713	Molecular Function	-
Sma3	protein binding	GO:0005515	Molecular Function	-
Sma3	metallopeptidase activity	GO:0008237	Molecular Function	-
Sma3	transcription activator activity	GO:0016563	Molecular Function	-
Sma3	transcription regulator activity	GO:0030528	Molecular Function	-
Sma3	protein homodimerization activity	GO:0042803	Molecular Function	-
Sma3	regulation of transcription, DNA-dependent	GO:0006355	Biological Process	-
Sma3	proteolysis	GO:0006508	Biological Process	-
Sma3	response to cytokinin stimulus	GO:0009735	Biological Process	-
Sma3	response to abscisic acid stimulus	GO:0009737	Biological Process	-
Sma3	response to brassinosteroid stimulus	GO:0009741	Biological Process	-
Sma3	lignin biosynthetic process	GO:0009809	Biological Process	-
Sma3	multidimensional cell growth	GO:0009825	Biological Process	-
Sma3	secondary cell wall biogenesis	GO:0009834	Biological Process	-
Sma3	anther dehiscence	GO:0009901	Biological Process	-
Sma3	flower development	GO:0009908	Biological Process	-
Sma3	meristem initiation	GO:0010014	Biological Process	-
Sma3	fruit dehiscence	GO:0010047	Biological Process	-
Sma3	xylem development	GO:0010089	Biological Process	-
Sma3	leaf senescence	GO:0010150	Biological Process	-
Sma3	organ boundary specification between lateral organs and the meristem	GO:0010199	Biological Process	-
Sma3	response to chitin	GO:0010200	Biological Process	-
Sma3		GO:0045449	Biological Process	-
Sma3	defense response to virus	GO:0051607	Biological Process	-

Source	InterPros	Term	Type	Identity
Sma3	7,8-Dihydro-6-hydroxymethylpterin-pyrophosphokinase, HPPK	IPR000550	-	-
Sma3	Peptidase M20	IPR002933	-	-
Sma3	No apical meristem (NAM) protein	IPR003441	-	-
Sma3	Phosphopantetheine attachment site	IPR006162	-	-
Sma3	Cytochrome c oxidase biogenesis protein Cmc1-like	IPR013892	-	-
Sma3	Glycoside hydrolase, family 9, active site	IPR018221	-	-

Source	Species	ID	Description	Identity
ATG	Arabidoptis thaliana	AT3G17730.1	anac057, NAC057 NAC domain containing protein 57 chr3:6064379-6065813 FORWARD LENGTH=246	63%
RefSeq	Arabidopsis thaliana	NP_188400.1	NAC domain containing protein 57 [Arabidopsis thaliana]	63%
RefSeq	Populus trichocarpa	XP_002318332.1	NAC domain protein, IPR003441, partial [Populus trichocarpa]	65%

Full-Lengther Next Prediction

Fln status: Putative Complete

Fln database: coniferopsida.fasta

Fln subject: A9NU17

Fln msg: atg_distance in limit (1-15): atg_distance = 15, W2: There is no M at the beginning,

Fln protein: TDEELISCYLKGKLNHGLKEAEIEVISEVDLYRNEPWDLPEKSFLPRGDLVWYFFSPCDRKYPNGSRTNRATEAGYWKATGRDRKVYSRANTVGIKKTLVFYRGRAPQGERTDWIMHEYRLEENECEAGPCLQVLFMNYSFFGMLFWDAVFK*

Protein Length: 154

Fln nts: ACTGACGAAGAACTTATATCCTGCTATCTCAAGGGCAAACTCAATCATGGCCTTAAAGAAGCAGAGATCGAGGTTATTAGCGAGGTCGACCTCTACAGAAACGAGCCCTGGGATTTGCCTGAGAAATCCTTCCTGCCCCGTGGTGATTTGGTGTGGTATTTCTTTAGTCCTTGTGACAGGAAGTATCCGAATGGTTCACGCACTAATAGGGCTACTGAAGCTGGGTATTGGAAAGCCACAGGAAGGGATCGTAAAGTTTACTCTCGAGCAAACACAGTAGGAATAAAAAAGACTCTAGTTTTCTATAGAGGCCGGGCTCCACAAGGTGAACGAACTGATTGGATAATGCATGAATATCGTCTTGAGGAAAATGAATGTGAGGCAGGACCTTGTTTGCAGGTATTATTTATGAATTATTCATTCTTTGGGATGCTGTTTTGGGATGCTGTTTTTAAGTGA___AATGTTTTTGTTTGGATACCATCATTATTGAAAACACCATCCATATTCATATTCATAGATAGATACATACACCTC

Fln Alignment:

AllPine_a_rep_c110059___TDEELISCYLKGKLNHGLKEAEIEVISEVDLYRNEPWDLPEKSFLPRGDLVWYFFSPCDRKYPNGSRTNRATEAGYWKATGRDRKVYSRANTVGIKKTLVFYRGRAPQGERTDWIMHEYRLEENECEAGPCLQV
A9NU17________________TDEELIFNYLKVKLKNGLKASEVEVIPDVDLYRCEPWDLPEKSFLPNTDMEWYFFSPRDRKYPNGSRTNRATEAGYWKATGRDRKVYSLASTIGIKKTLVFYRGRAPQGERTDWVMHEYRLEENECEAGPCLQM

Back

Biología Molecular y Biotecnología de Plantas, Facultad de Ciencias y Plataforma Andaluza de Bioinformática, Universidad de Málaga, E-29071 Málaga, Spain