SustainPineDB

Assembly Name: SustainPine v3.0

UniGene Name: sp_v3.0_unigene102075

Length: 823 nt

This UniGene was originaly assembled in antisense
ACE File: antisense
Fasta: sense

UniGene Fasta (sense)

Ace file of the UniGene sp_v3.0_unigene102075 (antisense)

Annotations

Source	Descriptions	Term	Type	e value	Identity
AutoFact	cellulose synthase-like protein D4 [Populus tremuloides]	-	-	0.0	78%
FL-Next	tr=Cellulose synthase catalytic subunit; Pinus taeda (Loblolly pine).	-	-	0.0	47%
Sma3	Cellulose synthase	-	-	1.34525e-43	-

Source	ECs	Term	Type	e value	Identity
Sma3	Transferases, Glycosyltransferases, Hexosyltransferases.	EC:2.4.1.-	-	4.933e-25	-

Source	KEGGs	Term	Type	e value	Identity
Sma3	Fructose and mannose metabolism	00051		4.933e-25	%
Sma3	N-Glycan biosynthesis	00510		4.933e-25	%
Sma3	Mucin type O-Glycan biosynthesis	00512		4.933e-25	%
Sma3	Various types of N-glycan biosynthesis	00513		4.933e-25	%
Sma3	Other types of O-glycan biosynthesis	00514		4.933e-25	%
Sma3	Biosynthesis of 12-, 14- and 16-membered macrolides	00522		4.933e-25	%
Sma3	Glycosaminoglycan biosynthesis - keratan sulfate	00533		4.933e-25	%
Sma3	Lipopolysaccharide biosynthesis	00540		4.933e-25	%
Sma3	Peptidoglycan biosynthesis	00550		4.933e-25	%
Sma3	Glycerolipid metabolism	00561		4.933e-25	%
Sma3	Glycosylphosphatidylinositol(GPI)-anchor biosynthesis	00563		4.933e-25	%
Sma3	Sphingolipid metabolism	00600		4.933e-25	%
Sma3	Glycosphingolipid biosynthesis - lacto and neolacto series	00601		4.933e-25	%
Sma3	Glycosphingolipid biosynthesis - globo series	00603		4.933e-25	%
Sma3	Glycosphingolipid biosynthesis - ganglio series	00604		4.933e-25	%
Sma3	Carotenoid biosynthesis	00906		4.933e-25	%
Sma3	Zeatin biosynthesis	00908		4.933e-25	%
Sma3	Flavonoid biosynthesis	00941		4.933e-25	%
Sma3	Anthocyanin biosynthesis	00942		4.933e-25	%
Sma3	Flavone and flavonol biosynthesis	00944		4.933e-25	%
Sma3	Stilbenoid, diarylheptanoid and gingerol biosynthesis	00945		4.933e-25	%
Sma3	Betalain biosynthesis	00965		4.933e-25	%
Sma3	Biosynthesis of type II polyketide products	01057		4.933e-25	%
Sma3	Metabolic pathways	01100		4.933e-25	%
Sma3	Biosynthesis of secondary metabolites	01110		4.933e-25	%
Sma3	Cellulose synthase (UDP-forming).	EC:2.4.1.12	-	0.0	-

Source	KEGGs	Term	Type	e value	Identity
Sma3	Starch and sucrose metabolism	00500		0.0	%

Source	Gene names
Sma3	ATHA; ATHB; At1g02730; At1g32180; At2g21770; At2g25540; At2g33100; At3g03050; At4g32410; At4g38190; At4g39350; At5g05170; At5g09870; At5g16910; At5g17420; At5g44030; At5g64740; CESA09; CESA1; CESA10; CESA13; CESA2; CESA3; CESA4; CESA5; CESA6; CESA7; CESA8

Source	GOs	Term	Type	Identity
Sma3	Golgi membrane	GO:0000139	Cellular Component	-
Sma3	endoplasmic reticulum	GO:0005783	Cellular Component	-
Sma3	Golgi apparatus	GO:0005794	Cellular Component	-
Sma3	plasma membrane	GO:0005886	Cellular Component	-
Sma3	chloroplast	GO:0009507	Cellular Component	-
Sma3	cellulose synthase complex	GO:0010330	Cellular Component	-
Sma3	membrane	GO:0016020	Cellular Component	-
Sma3	integral to membrane	GO:0016021	Cellular Component	-
Sma3	integral to Golgi membrane	GO:0030173	Cellular Component	-
Sma3	protein binding	GO:0005515	Molecular Function	-
Sma3	zinc ion binding	GO:0008270	Molecular Function	-
Sma3	oxidoreductase activity	GO:0016491	Molecular Function	-
Sma3	cellulose synthase (UDP-forming) activity	GO:0016760	Molecular Function	-
Sma3	1,4-beta-D-xylan synthase activity	GO:0047517	Molecular Function	-
Sma3	defense response	GO:0006952	Biological Process	-
Sma3	cellular cell wall organization	GO:0007047	Biological Process	-
Sma3	response to cold	GO:0009409	Biological Process	-
Sma3	primary cell wall biogenesis	GO:0009833	Biological Process	-
Sma3	secondary cell wall biogenesis	GO:0009834	Biological Process	-
Sma3	pollen germination	GO:0009846	Biological Process	-
Sma3	rhamnogalacturonan I side chain metabolic process	GO:0010400	Biological Process	-
Sma3	cell growth	GO:0016049	Biological Process	-
Sma3	cellulose biosynthetic process	GO:0030244	Biological Process	-
Sma3	hyperosmotic salinity response	GO:0042538	Biological Process	-
Sma3	cell wall biogenesis	GO:0042546	Biological Process	-
Sma3	defense response to bacterium	GO:0042742	Biological Process	-
Sma3	cortical microtubule organization	GO:0043622	Biological Process	-
Sma3	shoot development	GO:0048367	Biological Process	-
Sma3	root hair elongation	GO:0048767	Biological Process	-
Sma3	defense response to fungus	GO:0050832	Biological Process	-

Source	InterPros	Term	Type	Identity
Sma3	Pyridine nucleotide-disulphide oxidoreductase, class-II	IPR000103	-	-
Sma3	WD40 repeat	IPR001680	-	-
Sma3	Zinc finger, RING-type	IPR001841	-	-
Sma3	Lipocalin	IPR002345	-	-
Sma3	Cellulose synthase	IPR005150	-	-
Sma3	WD40/YVTN repeat-like-containing domain	IPR015943	-	-
Sma3	Zinc finger, RING-type, conserved site	IPR017907	-	-
Sma3	WD40-repeat-containing domain	IPR017986	-	-
Sma3	Gonadotropin, beta subunit, conserved site	IPR018245	-	-
Sma3	WD40 repeat, conserved site	IPR019775	-	-
Sma3		IPR019782	-	-

Source	Species	ID	Description	Identity
ATG	Arabidoptis thaliana	AT3G03050.1	CSLD3, KJK, ATCSLD3 cellulose synthase-like D3 chr3:687873-691629 FORWARD LENGTH=1145	76%
RefSeq	Arabidopsis thaliana	NP_186955.1	cellulose synthase-like protein D3 [Arabidopsis thaliana]	76%
RefSeq	Populus trichocarpa	XP_002325817.1	cellulose synthase-like protein [Populus trichocarpa]	78%

Full-Lengther Next Prediction

Fln status: Internal

Fln database: coniferopsida.fasta

Fln subject: Q5DI94

Fln msg: Distance to subject end: 626 aas, your sequence is shorter than subject: 274 - 1057

Fln protein: MSLMKQSKTKSILLRSQTADFDHNRWLFETNGTNGYGNAFWPKEESFSEDRDGMAGSLSDLNEKPWKPLTRKIKIAPGILSPYRLLIFIRLVALVFFLQWRIRNPNNDAMWLWGMSIVCELWFAFSWLLDQLPKFCPINRATDLNVLKEKFDRPGPNNPTGKSDLPGIDVFVSTADPEKEPPLVTANTILSILAADYPVEKLACYVSDDGGALLTFEAMAEAASFADLWVPFCRKHNIEPRNPESYFNLKRDPTKNKLRHDFVKDRRRIKREYD

Protein Length: 275

Fln nts: GATGTCATTGATGAAACAAAGCAAGACCAAGTCCATCCTTTTGAGGAGCCAAACTGCAGATTTTGATCACAATCGTTGGCTTTTTGAGACAAATGGGACTAATGGCTATGGCAATGCTTTTTGGCCCAAGGAGGAGTCCTTTTCTGAAGATAGGGACGGAATGGCTGGGAGTCTCTCTGATCTGAATGAGAAGCCATGGAAGCCTCTTACTCGCAAGATCAAAATCGCCCCTGGCATTCTCAGCCCTTACAGGTTACTTATTTTCATACGACTGGTTGCTTTGGTATTCTTCCTCCAATGGCGAATCCGGAATCCCAACAATGATGCAATGTGGCTATGGGGAATGTCAATTGTATGTGAGCTCTGGTTTGCCTTCTCATGGTTGCTGGATCAATTACCAAAATTTTGTCCCATCAATCGTGCTACTGATCTCAATGTTCTCAAGGAGAAATTTGATAGGCCAGGCCCTAATAATCCAACAGGAAAATCTGATTTGCCAGGGATTGATGTGTTTGTTTCTACCGCTGATCCAGAGAAGGAACCACCACTGGTCACCGCTAATACCATCCTATCAATCCTTGCTGCCGATTATCCAGTAGAGAAGCTTGCATGCTATGTATCAGATGATGGAGGTGCTCTTCTCACATTTGAAGCCATGGCAGAAGCAGCAAGCTTTGCGGACCTTTGGGTTCCTTTCTGTCGCAAGCATAACATTGAACCTCGAAACCCTGAGAGTTACTTCAACCTCAAGAGAGATCCCACCAAGAACAAACTGCGACATGACTTTGTCAAGGATCGCAGAAGGATTAAGAGGGAGTATGAT

Fln Alignment:

AllPine_a_c30438___YGNAFWPKE-ESFSEDRDGMAGSLSD-------------LNEKPWKPLTRKIKIAPGILSPYRLLIFIRLVALVFFLQWRIRNPNNDAMWLWGMSIVCELWFAFSWLLDQLPKFCPINRATDLNVLKEKFDRPGPNNPTGKSDLPGIDVFVSTADPEKEPPLVTANTILSILAADYPVEKLACYVSDDGGALLTFEAMAEAASFADLWVPFCRKHNIEPRNPESYFNLKRDPTKNKLRHDFVKDRRRIKREYD
Q5DI94________________YGSAAWKERVENWKAKHDKKSGSIKDGIYDPDEADDIMMTEAEARQPLSRKVPIPSSLINPYRIVIVLRLIILGFFFRYRLMNPAKDALGLWLTSIICEIWFAFSWILDQFPKWFPITRETYLDRLSMRYEREGE-----PCKLAPVDFFVSTVDPLKEPPLITANTVLSILAADYPVDRVSCYVSDDGASMLTFDSMTETSEFARKWVPFCKKYSIEPRAPDFYFSQKIDYLKDKVQPTFVKERRAMKREYE

SNPs (tot: 1)

Position	A %	C %	G %	T %	Probability
184	80		20		0.995493

Back

Biología Molecular y Biotecnología de Plantas, Facultad de Ciencias y Plataforma Andaluza de Bioinformática, Universidad de Málaga, E-29071 Málaga, Spain