UniGene Name: sp_v3.0_unigene85710
Length:
247 nt
>sp_v3.0_unigene85710
CTTCGTGGTAAGCAATTCTCTTAAGCGACGAATGGCCTTAAGAGAATTGCTTACCACGAAGCTTCCACCTGGTACATTTCCTGTCAAGGTTGCTATTCCAGTTGTTCCTACTGTAAAAGTAACAATCACTCTAACAGTAGGAACAACTGGAATAGCGATTGTTACTTTTACTAAATTTGAAGAACTGCAACCATCTGAAGAGTTTTCTACCCCACCTTCGAGTCCTGGGAATTTGCAAGATATGAAG |
If you push the Download ace button, you will download an ace file of this UniGene.
To watch this ACE file you will need an ACE viewer program as Tablet:
Go to the Tablet ACE viewer Web
Source |
Gene names |
Sma3 |
At1g04780; At1g04780/F13M7_20; At3g04470; At3g24210; F13M7.23; GSVIVT00006339001; GSVIVT00032887001; OJ1112_G06.34; OSJNBb0095H08.9; Os02g0810100; OsI_09382; OsI_25807; OsJ_08814; OsJ_24036; PHYPADRAFT_161854; PHYPADRAFT_196895; POPTRDRAFT_738251; POPTRDR |
Source |
GOs |
Term |
Type |
e value |
Identity |
Sma3 |
plasma membrane
|
GO:0005886
|
Cellular Component
|
0.0 |
-
|
Source |
InterPros |
Term |
Type |
e value |
Identity |
Sma3 |
Ankyrin repeat
|
IPR002110
|
-
|
0.0 |
-
|
Fln status:
coding
Fln database:
testcode
Fln subject:
Fln msg:
Test code:
1
Test Code was used to find complete genes when there was not found a reliable orthologue.
The best ORF (Open Reading Frame) is shown, and only ORFs > 200pb were analyzed.
Your ORF will be more reliable if a stop codon was found before the start codon.
A Test Code value > 0.95 means the ORF is probably coding.
A Test Code value < 0.74 means the ORF is probably non-coding.
Test Code values in between 0.74 and 0.95 mean it is uncertain whether the ORF is coding or not.
Back