UniGene Name: sp_v3.0_unigene75495
Length: 65 nt
If you push the Download ace button, you will download an ace file of this UniGene. To watch this ACE file you will need an ACE viewer program as Tablet: Go to the Tablet ACE viewer Web
Fln status: Internal
Fln database: sp_plants
Fln subject: Q8LMR2
Fln msg: Distance to subject end: 1450 aas, your sequence is shorter than subject: 21 - 1883
Fln protein: RNLESKLDSIVCTIKDRKELE Protein Length: 22
Fln nts: CGAAATCTGGAAAGCAAGCTTGATTCTATTGTGTGCACAATCAAAGATAGGAAGGAACTTGAAAA
Fln Alignment:
GFIJCBT03FMUUS___RNLESKLDSIVCTIKDRKELEQ8LMR2_______________RNLESKLDSVVCTIKDRKELE
Biología Molecular y Biotecnología de Plantas, Facultad de Ciencias y Plataforma Andaluza de Bioinformática, Universidad de Málaga, E-29071 Málaga, Spain