UniGene Name: sp_v3.0_unigene73875
Length: 80 nt
If you push the Download ace button, you will download an ace file of this UniGene. To watch this ACE file you will need an ACE viewer program as Tablet: Go to the Tablet ACE viewer Web
Fln status: Internal
Fln database: tr_plants
Fln subject: B9HVN6
Fln msg: Unexpected stop codon in the beginning of your sequence, Distance to subject end: 510 aas, your sequence is shorter than subject: 26 - 752
Fln protein: *LHRKGIGGAILADEMGLGKTVQAII Protein Length: 27
Fln nts: GTTGACTGCATCGCAAAGGGATTGGAGGAGCTATTCTGGCTGATGAGATGGGACTTGGTAAGACCGTACAGGCTATCATA
Fln Alignment:
GFIJCBT03GD87A___LHRKGIGGAILADEMGLGKTVQAIB9HVN6_______________LHRKGIGGAILADEMGLGKTIQAI
Biología Molecular y Biotecnología de Plantas, Facultad de Ciencias y Plataforma Andaluza de Bioinformática, Universidad de Málaga, E-29071 Málaga, Spain