UniGene Name: sp_v3.0_unigene72158
Length: 149 nt
If you push the Download ace button, you will download an ace file of this UniGene. To watch this ACE file you will need an ACE viewer program as Tablet: Go to the Tablet ACE viewer Web
Fln status: N-terminus
Fln database: coniferopsida.fasta
Fln subject: C0PR52
Fln msg: Distance to subject end: 921 aas, your sequence is shorter than subject: 26 - 948
Fln protein: MEKSCSLLIHFDKGTPAMANEIKGIP Protein Length: 27
Fln nts: CGTCGTGACCTTGGCTGTCACTCAATATCTGTTGCTGCTGAAACTTTTGAAACCCTCGACGGCCAAAAG_-_ATGGAGAAATCCTGCAGTCTGCTGATCCACTTCGACAAGGGGACGCCGGCTATGGCGAATGAGATCAAAGGAATCCCTGG
Fln Alignment:
GG46A6U02HZ3IA___MEKSCSLLIHFDKGTPAMANEIKC0PR52_______________MEKSCSLLIHFDKGNPAMANEIK
Biología Molecular y Biotecnología de Plantas, Facultad de Ciencias y Plataforma Andaluza de Bioinformática, Universidad de Málaga, E-29071 Málaga, Spain