UniGene Name: sp_v3.0_unigene64910
Length: 80 nt
If you push the Download ace button, you will download an ace file of this UniGene. To watch this ACE file you will need an ACE viewer program as Tablet: Go to the Tablet ACE viewer Web
Fln status: Internal
Fln database: sp_plants
Fln subject: Q94FB9
Fln msg: Distance to subject end: 687 aas, your sequence is shorter than subject: 26 - 1337
Fln protein: RAMGTSCITISHRPALVAFHDTVLSL Protein Length: 27
Fln nts: TCCGTGCAATGGGTACATCGTGCATCACAATATCTCACAGGCCTGCCCTTGTGGCATTTCATGACACTGTTCTATCTCTA
Fln Alignment:
G5KS2UX02H8CDF___RAMGTSCITISHRPALVAFHDTVLSLQ94FB9_______________RAMGTSCITISHRPALVAFHDVVLSL
Biología Molecular y Biotecnología de Plantas, Facultad de Ciencias y Plataforma Andaluza de Bioinformática, Universidad de Málaga, E-29071 Málaga, Spain