SustainPineDB

All assemblies
Assembly info
Unigenes
SNPs
SSRs
Descriptions
GOs
ECs
KEGGs
InterPros
miRNAs

Assembly Name: SustainPine v3.0

UniGene Name: sp_v3.0_unigene64027

Length: 96 nt

This UniGene was originaly assembled in antisense
ACE File: antisense
Fasta: sense

UniGene Fasta (sense)

>sp_v3.0_unigene64027
AACGAACTCGAATTGGATTGATTGTAGAGTCAGGGGAGCCACGTGAAGTGCATCATTTCTGCACGCTAGTAGGGTTTGGAGCAGAATAGCTATATG

Ace file of the UniGene sp_v3.0_unigene64027 (antisense)

If you push the Download ace button, you will download an ace file of this UniGene.

To watch this ACE file you will need an ACE viewer program as Tablet:

Go to the Tablet ACE viewer Web

Annotations

Source	Descriptions	Term	Type	e value	Identity
AutoFact	Glutamate synthase, putative n=1 Tax=Ricinus communis RepID=B9RII5_RICCO	-	-	2.0e-07	92%
FL-Next	sp=Glutamate synthase 1 [NADH], chloroplastic; Oryza sativa subsp. japonica (Rice).	-	-	0.0	85%
Sma3	NADH-dependent glutamate synthase	-	-	2.059e-09	-

Source	ECs	Term	Type	e value	Identity
Sma3	Glutamate synthase (NADH).	EC:1.4.1.14	-	7.648e-15	-

Source	KEGGs	Term	e value	Identity
Sma3	Alanine, aspartate and glutamate metabolism	00250	7.648e-15	%
Sma3	Nitrogen metabolism	00910	7.648e-15	%
Sma3	Biosynthesis of alkaloids derived from ornithine, lysine and nicotinic acid	01064	7.648e-15	%
Sma3	Metabolic pathways	01100	7.648e-15	%
Sma3	Biosynthesis of secondary metabolites	01110	7.648e-15	%

Source	Gene names
Sma3	GLT2; GSVIVT00037107001; NGS; Os01g0681900; OsI_03285; OsI_20922; OsJ_03025; OsJ_19492; PHYPADRAFT_182528; PHYPADRAFT_212395; POPTRDRAFT_594762; POPTRDRAFT_824538; RCOM_1579610;

Source	GOs	Term	Type	Identity
Sma3	amyloplast	GO:0009501	Cellular Component	-
Sma3	chloroplast stroma	GO:0009570	Cellular Component	-
Sma3	iron ion binding	GO:0005506	Molecular Function	-
Sma3	electron carrier activity	GO:0009055	Molecular Function	-
Sma3	FMN binding	GO:0010181	Molecular Function	-
Sma3	glutamate synthase activity	GO:0015930	Molecular Function	-
Sma3	glutamate synthase (NADH) activity	GO:0016040	Molecular Function	-
Sma3	glutamate synthase activity, NADH or NADPH as acceptor	GO:0045181	Molecular Function	-
Sma3	flavin adenine dinucleotide binding	GO:0050660	Molecular Function	-
Sma3	iron-sulfur cluster binding	GO:0051536	Molecular Function	-
Sma3	3 iron, 4 sulfur cluster binding	GO:0051538	Molecular Function	-
Sma3	glutamate biosynthetic process	GO:0006537	Biological Process	-
Sma3	glutamine metabolic process	GO:0006541	Biological Process	-
Sma3	nitrogen compound metabolic process	GO:0006807	Biological Process	-
Sma3	response to cadmium ion	GO:0046686	Biological Process	-
Sma3	oxidation-reduction process	GO:0055114	Biological Process	-

Source	InterPros	Term	Type	Identity
Sma3	Glutamine amidotransferase, class-II	IPR000583	-	-
Sma3		IPR000759	-	-
Sma3	Pyridine nucleotide-disulphide oxidoreductase, NAD-binding domain	IPR001327	-	-
Sma3	Glutamate synthase, alpha subunit, C-terminal	IPR002489	-	-
Sma3	Glutamate synthase, central-C	IPR002932	-	-
Sma3	Glutamate synthase, NADH/NADPH, small subunit 1	IPR006005	-	-
Sma3	Glutamate synthase, central-N	IPR006982	-	-
Sma3	Glutamate synthase, eukaryotic	IPR012220	-	-
Sma3	Fumarate reductase, C-terminal	IPR012285	-	-
Sma3	FAD-dependent pyridine nucleotide-disulphide oxidoreductase	IPR013027	-	-
Sma3	Aldolase-type TIM barrel	IPR013785	-	-
Sma3	NAD(P)-binding domain	IPR016040	-	-
Sma3	Glutamine amidotransferase, type II	IPR017932	-	-

Source	Species	ID	Description	e value	Identity
ATG	Arabidoptis thaliana	AT5G53460.1	GLT1 NADH-dependent glutamate synthase 1 chr5:21700518-21709629 FORWARD LENGTH=2208	6.0e-11	82%
RefSeq	Arabidopsis thaliana	NP_200158.2	glutamate synthase 1 [NADH] [Arabidopsis thaliana]	8.0e-11	82%
RefSeq	Populus trichocarpa	XP_002321436.1	predicted protein [Populus trichocarpa]	6.0e-11	85%

Full-Lengther Next Prediction

Fln status: Internal

Fln database: sp_plants

Fln subject: Q0JKD0

Fln msg: Unexpected STOP codon at 3' end. Distance to subject end: 1374 aas, your sequence is shorter than subject: 29 - 2167

Fln protein: RTRIGLIVESGEPREVHHFCTLVGFGAE*

Protein Length: 30

Fln nts: AACGAACTCGAATTGGATTGATTGTAGAGTCAGGGGAGCCACGTGAAGTGCATCATTTCTGCACGCTAGTAGGGTTTGGAGCAGAATAGCTATATG

Fln Alignment:

G5KS2UX02GU6DN___RTRIGLIVESGEPREVHHFCTLVGFGAE
Q0JKD0_______________RTRVGLLVESAEPREVHHFCTLVGFGAD

Back

Biología Molecular y Biotecnología de Plantas, Facultad de Ciencias y Plataforma Andaluza de Bioinformática, Universidad de Málaga, E-29071 Málaga, Spain