UniGene Name: sp_v3.0_unigene61107
Length: 83 nt
If you push the Download ace button, you will download an ace file of this UniGene. To watch this ACE file you will need an ACE viewer program as Tablet: Go to the Tablet ACE viewer Web
Fln status: Internal
Fln database: coniferopsida.fasta
Fln subject: P10053
Fln msg: Unexpected STOP codon at 3' end. Distance to subject end: 56 aas, your sequence is shorter than subject: 20 - 171
Fln protein: CVPCLEFDLEGSISRKYNK* Protein Length: 21
Fln nts: AATGTGTGCCTTGTCTAGAGTTTGATCTGGAAGGATCCATCTCGAGGAAGTATAATAAGTAGCCCGGGGTACGTACGATGGAA
Fln Alignment:
G5KS2UX02G1ZPV___VPCLEFDLEGSISRKYNK*PGP10053_______________VPCLEFDLEGSISRKYNRSPG
Biología Molecular y Biotecnología de Plantas, Facultad de Ciencias y Plataforma Andaluza de Bioinformática, Universidad de Málaga, E-29071 Málaga, Spain