UniGene Name: sp_v3.0_unigene58727
Length: 81 nt
If you push the Download ace button, you will download an ace file of this UniGene. To watch this ACE file you will need an ACE viewer program as Tablet: Go to the Tablet ACE viewer Web
Fln status: Internal
Fln database: coniferopsida.fasta
Fln subject: H9B580
Fln msg: Unexpected stop codon in the beginning of your sequence, Distance to subject end: 78 aas, your sequence is shorter than subject: 27 - 123
Fln protein: **MCGVAVSVEGAISCNQVVSAMTPCA Protein Length: 28
Fln nts: TGATGAATGTGTGGGGTGGCTGTGAGTGTGGAAGGTGCCATATCATGCAACCAGGTGGTGAGTGCCATGACTCCATGCGCT
Fln Alignment:
F7JJN6E01EVCUK___AVSVEGAISCNQVVSAMTPCAH9B580_______________AVSVEGAISCNQVVSAMTPCA
Biología Molecular y Biotecnología de Plantas, Facultad de Ciencias y Plataforma Andaluza de Bioinformática, Universidad de Málaga, E-29071 Málaga, Spain