SustainPineDB

All assemblies
Assembly info
Unigenes
SNPs
SSRs
Descriptions
GOs
ECs
KEGGs
InterPros
miRNAs

Assembly Name: SustainPine v3.0

UniGene Name: sp_v3.0_unigene58004

Length: 293 nt

UniGene Fasta

>sp_v3.0_unigene58004
AAAAATCTTCGTATATGCACTGACTGTCATACTGCCACCAAATTAATATCAAAGATTGTTGAACGTGAAATTGTTACCAGGGATGCCAACCGCTTCCATCATTTCAAGGGTGGTCTTTGTTCATGTGGAGATTATTGGTGATGCTTCTGCTCCTTTATTTATTGGCATTTCATCGGTTACAATTTCTGTTATGGTAGCTTAATGCTTTTAGGAGCGTTGCATAATAATCAGATGAAAGTCCAATATGCCTATCCAGACATGCTGAGGTTGCTAAAGTTCATGGCTTCTTGGGT

Ace file of the UniGene sp_v3.0_unigene58004

If you push the Download ace button, you will download an ace file of this UniGene.

To watch this ACE file you will need an ACE viewer program as Tablet:

Go to the Tablet ACE viewer Web

Annotations

Source	Descriptions	Term	Type	e value	Identity
AutoFact	pentatricopeptide repeat-containing protein [Arabidopsis thaliana] sp\|Q9SUH6.1\|PP341_ARATH RecName: Full=Pentatricopeptide repeat-containing protein At4g30700; AltName: Full=Protein DYW9 emb\|CAB52443.1\| putative protein [Arabidopsis thaliana] emb\|CAB79788	-	-	3.0e-17	82%
FL-Next	tr=Putative uncharacterized protein; Picea sitchensis (Sitka spruce) (Pinus sitchensis).	-	-	0.0	86%
Sma3	Putative pentatricopeptide (PPR) repeat-containing protein	-	-	7.681e-09	-

Source	Gene names
Sma3	At1g08070; At1g09410; At1g11290; At1g18485; At1g31920; At1g56690; At2g22070; At3g02010; At3g12770; At3g23330; At3g24000; At3g26782; At3g46790; At3g49140; At3g57430; At3g63370; At4g16835; At4g21065; At4g30700; At4g32450; At4g33170; At4g33990; At4g37380; At

Source	GOs	Term	Type	Identity
Sma3	mitochondrion	GO:0005739	Cellular Component	-
Sma3	chloroplast	GO:0009507	Cellular Component	-
Sma3	DNA binding	GO:0003677	Molecular Function	-
Sma3	endonuclease activity	GO:0004519	Molecular Function	-
Sma3	binding	GO:0005488	Molecular Function	-
Sma3	methyltransferase activity	GO:0008168	Molecular Function	-
Sma3	acireductone synthase activity	GO:0043874	Molecular Function	-
Sma3	metal ion binding	GO:0046872	Molecular Function	-
Sma3	DNA methylation	GO:0006306	Biological Process	-
Sma3	metabolic process	GO:0008152	Biological Process	-
Sma3	mRNA modification	GO:0016556	Biological Process	-
Sma3	L-methionine salvage from methylthioadenosine	GO:0019509	Biological Process	-
Sma3	chloroplast RNA processing	GO:0031425	Biological Process	-
Sma3	polycistronic mRNA processing	GO:0031426	Biological Process	-

Source	InterPros	Term	Type	Identity
Sma3	Peptidase S8/S53, subtilisin/kexin/sedolisin	IPR000209	-	-
Sma3	Protein kinase, catalytic domain	IPR000719	-	-
Sma3	C-5 cytosine methyltransferase	IPR001525	-	-
Sma3	Pentatricopeptide repeat	IPR002885	-	-
Sma3	Immunoglobulin/major histocompatibility complex, conserved site	IPR003006	-	-
Sma3	MAP kinase, conserved site	IPR003527	-	-
Sma3	Haloacid dehalogenase-like hydrolase	IPR005834	-	-
Sma3	Uncharacterised protein family Cys-rich	IPR006461	-	-
Sma3	Domain of unknown function DUF659	IPR007021	-	-
Sma3	2,3-diketo-5-methylthio-1-phosphopentane phosphatase	IPR010041	-	-
Sma3		IPR011523	-	-
Sma3	Tetratricopeptide-like helical	IPR011990	-	-
Sma3	Methyltransferase type 11	IPR013216	-	-
Sma3		IPR017442	-	-
Sma3	Thioredoxin, conserved site	IPR017937	-	-
Sma3		IPR018115	-	-
Sma3	Asp/Glu racemase, active site	IPR018187	-	-
Sma3	EF-Hand 1, calcium-binding site	IPR018247	-	-
Sma3	WD40 repeat, conserved site	IPR019775	-	-

Source	Species	ID	Description	e value	Identity
ATG	Arabidoptis thaliana	AT4G30700.1	Pentatricopeptide repeat (PPR) superfamily protein chr4:14962617-14964995 REVERSE LENGTH=792	7.0e-22	82%
RefSeq	Arabidopsis thaliana	NP_194799.1	pentatricopeptide repeat-containing protein [Arabidopsis thaliana]	9.0e-22	82%
RefSeq	Populus trichocarpa	XP_002322762.1	predicted protein [Populus trichocarpa]	2.0e-21	78%

Full-Lengther Next Prediction

Fln status: C-terminus

Fln database: coniferopsida.fasta

Fln subject: D5AAE0

Fln msg: your sequence is shorter than subject: 47 - 246

Fln protein: KNLRICTDCHTATKLISKIVEREIVTRDANRFHHFKGGLCSCGDYW*

Protein Length: 48

Fln nts: AAAAATCTTCGTATATGCACTGACTGTCATACTGCCACCAAATTAATATCAAAGATTGTTGAACGTGAAATTGTTACCAGGGATGCCAACCGCTTCCATCATTTCAAGGGTGGTCTTTGTTCATGTGGAGATTATTGGTGA___TGCTTCTGCTCCTTTATTTATTGGCATTTCATCGGTTACAATTTCTGTTATGGTAGCTTAATGCTTTTAGGAGCGTTGCATAATAATCAGATGAAAGTCCAATATGCCTATCCAGACATGCTGAGGTTGCTAAAGTTCATGGCTTCTTGGGT

Fln Alignment:

F51TW9001C1ADG___KNLRICTDCHTATKLISKIVEREIVTRDANRFHHFKGGLCSCGDYW
D5AAE0_______________KNLRVCGDCHTATKFISKIVEREIIIRDANRFHHFKDGLCSCGDYW

Back

Biología Molecular y Biotecnología de Plantas, Facultad de Ciencias y Plataforma Andaluza de Bioinformática, Universidad de Málaga, E-29071 Málaga, Spain