UniGene Name: sp_v3.0_unigene53903
Length: 78 nt
If you push the Download ace button, you will download an ace file of this UniGene. To watch this ACE file you will need an ACE viewer program as Tablet: Go to the Tablet ACE viewer Web
Fln status: Internal
Fln database: coniferopsida.fasta
Fln subject: H9B580
Fln msg: Distance to subject end: 79 aas, your sequence is shorter than subject: 26 - 123
Fln protein: NDECVGAVSVEGAISCNQVVSAMTPC Protein Length: 27
Fln nts: AATGATGAATGTGTGGGTGCTGTGAGTGTGGAAGGTGCCATATCATGCAACCAGGTGGTGAGTGCCATGACTCCATGC
Fln Alignment:
F585NNT02GNPRZ___GAVSVEGAISCNQVVSAMTPCH9B580_______________GAVSVEGAISCNQVVSAMTPC
Biología Molecular y Biotecnología de Plantas, Facultad de Ciencias y Plataforma Andaluza de Bioinformática, Universidad de Málaga, E-29071 Málaga, Spain