UniGene Name: sp_v3.0_unigene52732
Length: 78 nt
If you push the Download ace button, you will download an ace file of this UniGene. To watch this ACE file you will need an ACE viewer program as Tablet: Go to the Tablet ACE viewer Web
Fln status: Internal
Fln database: sp_plants
Fln subject: O82485
Fln msg: Distance to subject end: 540 aas, your sequence is shorter than subject: 25 - 766
Fln protein: WAGIFRWYLVEPAAMWWPANLVLSF Protein Length: 26
Fln nts: ATGGGCCGGCATATTCCGCTGGTATTTGGTAGAACCAGCTGCTATGTGGTGGCCTGCAAATCTTGTCCTAAGTTTCCT
Fln Alignment:
F5V9AAZ02GEVHM___WAGIFRWYLVEPAAMWWPANLVO82485_______________WAGIFRKYLVEPAAMWWPANLV
Biología Molecular y Biotecnología de Plantas, Facultad de Ciencias y Plataforma Andaluza de Bioinformática, Universidad de Málaga, E-29071 Málaga, Spain