SustainPineDB

Assembly Name: inia v1.0

UniGene Name: inia_v1.0_unigene4072

Length: 864 nt

This UniGene was originaly assembled in antisense
ACE File: antisense
Fasta: sense

UniGene Fasta (sense)

Ace file of the UniGene inia_v1.0_unigene4072 (antisense)

Annotations

Parent Assembly	Parent UniGene	Reads (related/total)
SustainPine v2.0	sp_v2.0_unigene24767	22/24
SustainPine v2.0	sp_v2.0_unigene24768	2/24

Source	Descriptions	Term	Type	Identity
AutoFact	[O] COG5272 Ubiquitin	-	-	97%
FL-Next	tr=Putative polyubiquitin; Picea abies (Norway spruce) (Picea excelsa).	-	-	100%
Blast2go	ubiquitin	-	-	99%

Source	GOs	Term	Type	Identity
Blast2go	protein modification process	GO:0006464	Biological Process	99%
Blast2go	ubiquitin-dependent protein catabolic process	GO:0006511	Biological Process	99%
Blast2go	response to salicylic acid stimulus	GO:0009751	Biological Process	99%
Blast2go	aging	GO:0007568	Biological Process	99%
Blast2go	intracellular part	GO:0044424	Cellular Component	99%

Source	InterPros	Term	Type	e value	Identity
Sma3	Ubiquitin	IPR000626	-	0.0	-

Full-Lengther Next Prediction

Fln status: Putative Complete

Fln database: coniferopsida.fasta

Fln subject: Q7FPA4

Fln msg: ERROR#3, very serious frame error, warning!, putative chimeric sequence! or repetitive structureatg_distance in limit (1-15): atg_distance = 2, W2: There is no M at the beginning,

Fln protein: QIFVKTLTGKTITLEVESSDTIDNxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxMQIFVKTLTGKTITLEVESSDTIDNVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKESTLHLVLRLRGGL*

Protein Length: 231

Fln nts: TGCAGATATTTGTGAAGACATTGACCGGAAAAACCATAACCCTCGAGGTCGAGAGCTCAGATACCATAGACAATxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTATGCAGATATTTGTGAAAACGTTGACAGGCAAGACCATCACACTAGAGGTTGAGAGCTCTGATACGATTGATAACGTGAAGGCTAAGATTCAAGACAAGGAAGGTATTCCTCCTGATCAGCAGAGGCTCATTTTTGCCGGCAAGCAGCTGGAGGATGGCCGAACCCTCGCCGATTATAACATTCAAAAGGAATCCACCCTCCACCTTGTCTTGCGTCTGCGTGGTGGCCTTTGAGATTGTGGGGAATGAATTTCACTTGACGTTAAAGCCTTGCCGTGTAAAGGCTTCGTGTTTTATCAGTTTTAGATGTTGACTTCGTATTCTCTGTTGTTAGACATTCCTTTACAAAGATTAGCGGCTGTATCGGGTGTCAATGTTATGTGAATTATGCACTTCTACTTTTGTGATTG

Fln Alignment:

Contig4072___xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx
Q7FPA4________________xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx

SNPs (tot: 18)

Position	A %	C %	G %	T %	Probability
339		11		88	0.923564
497		62		37	1.0
557	14		85		0.993533
563	33		66		1.0
569	37		62		1.0
614	28		71		1.0
620	28		71		1.0
632	14		85		0.993533
650		28	71		1.0
674	14	85			0.993533
680		71		28	1.0
698	57		14	28	1.0
701	71		28		1.0
704	71			28	1.0
705	14		85		0.993533
707			71	28	1.0
710			28	71	1.0
713	66		33		0.997452

Back

Biología Molecular y Biotecnología de Plantas, Facultad de Ciencias y Plataforma Andaluza de Bioinformática, Universidad de Málaga, E-29071 Málaga, Spain