UniGene Name: uagpf_v2_unigene35355
Length: 83 nt
If you push the Download ace button, you will download an ace file of this UniGene. To watch this ACE file you will need an ACE viewer program as Tablet: Go to the Tablet ACE viewer Web
Fln status: N-terminus
Fln database: coniferopsida.fasta
Fln subject: B8LL06
Fln msg: Distance to subject end: 417 aas, your sequence is shorter than subject: 25 - 442
Fln protein: MSSAILSKAFLQVSLRDGTLEGPGM Protein Length: 26
Fln nts: AGCCAAA_-_ATGAGCTCTGCAATACTCTCAAAGGCATTCTTGCAGGTTTCTCTCAGAGATGGAACCCTGGAGGGACCTGGGATGT
Fln Alignment:
uagpf_mira_c22926___MSSAILSKAFLQVSLRDGTLEGPGMB8LL06________________MSSAILSKAFLQVSLKDGTLERPGM
Biología Molecular y Biotecnología de Plantas, Facultad de Ciencias y Plataforma Andaluza de Bioinformática, Universidad de Málaga, E-29071 Málaga, Spain