UniGene Name: uagpf_v2_unigene49313
Length:
246 nt
>uagpf_v2_unigene49313
CGTCGTGACCTTGGCTGTCACTCATCTGATAGATAGTGAAAGAGAATTACTTTGCCAGAAAAACACAGAGGTCAGTACTGAATTGCAGTCTGTGAAGACCCAGTTGGTGGCAGTGAAGGCAGCATATGATGAAGAAACTGTTTACCTGAATAAGATCAGAGAAGAAAAAAAGGCTTCAGATGACAAATTGATGTTACAGCTCTCTAGAAATAATGTATTAGAAGAAGAGTTGCTGTCAGCAGAGTT |
If you push the Download ace button, you will download an ace file of this UniGene.
To watch this ACE file you will need an ACE viewer program as Tablet:
Go to the Tablet ACE viewer Web
Fln status:
Coding
Fln database:
testcode
Fln subject:
Fln msg:
Test code:
0
Test Code was used to find complete genes when there was not found a reliable orthologue.
The best ORF (Open Reading Frame) is shown, and only ORFs > 200pb were analyzed.
Your ORF will be more reliable if a stop codon was found before the start codon.
A Test Code value > 0.95 means the ORF is probably coding.
A Test Code value < 0.74 means the ORF is probably non-coding.
Test Code values in between 0.74 and 0.95 mean it is uncertain whether the ORF is coding or not.
Position |
A % |
C % |
G % |
T % |
Probability |
146 |
|
66 |
33 |
|
0.997454 |
Back