UniGene Name: biog3_v1.0_unigene14298
Length: 201 nt
If you push the Download ace button, you will download an ace file of this UniGene. To watch this ACE file you will need an ACE viewer program as Tablet: Go to the Tablet ACE viewer Web
Fln status: N-terminus
Fln database: coniferopsida.fasta
Fln subject: D5AEG3
Fln msg: Distance to subject end: 151 aas, your sequence is shorter than subject: 23 - 174
Fln protein: MEDEAVNIAVHRSSTRIRKVAPR Protein Length: 24
Fln nts: ACGTAACATCTACGGTGGAATAGAGGCAGTAGTCTCTGCAGAACGCAGCAGTCTGGGCAGTCTCAGAACATCAAACGTTGTGGGTTAAGCTAAAATAGAGTTTTGAATCAGTAGTGGTTTACAGTCAAAACA_-_ATGGAGGATGAAGCAGTTAACATTGCCGTGCACCGGTCATCTACTCGTATTCGCAAGGTTGCTCCTAGG
Fln Alignment:
biogeco3_mira_c7082___MEDEAVNIAVHRSSTRIRKVAPRD5AEG3__________________MEDEAVNIAVHRSSTRIRKVAPK
Biología Molecular y Biotecnología de Plantas, Facultad de Ciencias y Plataforma Andaluza de Bioinformática, Universidad de Málaga, E-29071 Málaga, Spain