SustainPineDB

All assemblies
Assembly info
Unigenes
SNPs
SSRs
Descriptions
GOs
ECs
KEGGs
InterPros
miRNAs

Assembly Name: biogeco3 v1.0

UniGene Name: biog3_v1.0_unigene2537

Length: 321 nt

UniGene Fasta

>biog3_v1.0_unigene2537
AATGTCTTCCTCTTCAGCTTCGTCTTTCCAGGAAGAAAGCTACGGAAGTGCAGCGGGCTGGGTGGAAGCTCGCACAGATTGCCCCCATCTGCAGGTTCTGTGTTCTGATCTTCGACATATACCCGGCCTTGACACTCCCTGCAAGAGGTGTGACCATCCTGCAGAAAATTGGATTTGCCTGAGCTGTAAAGAGGTTCTCTGCAGCCGCTTCATCAATGGTCACATGCTTGAGCACTATGAAAATACTGGGCATTGCTTGGCTATCAGCTACAGTGATCTTTCAGTGTGGTGCTTTTCATGCGATGCTTATTTAGATACATT

Ace file of the UniGene biog3_v1.0_unigene2537

If you push the Download ace button, you will download an ace file of this UniGene.

To watch this ACE file you will need an ACE viewer program as Tablet:

Go to the Tablet ACE viewer Web

Annotations

Parent Assembly	Parent UniGene	Reads (related/total)
SustainPine v2.0	sp_v2.0_unigene10848	2/2

Source	Descriptions	Term	Type	e value	Identity
AutoFact	PREDICTED: histone deacetylase 6-like isoform 8 [Macaca mulatta]	-	-	5.0e-22	48%
FL-Next	tr=Predicted protein; subsp. trichocarpa).	-	-	0.0	71%
Blast2go	histone deacetylase	-	-	0.0	72%

Source	GOs	Term	Type	Identity
Blast2go	positive regulation of chaperone-mediated protein complex assembly	GO:0090035	Biological Process	72%
Blast2go	positive regulation of receptor biosynthetic process	GO:0010870	Biological Process	72%
Blast2go	positive regulation of apoptotic process	GO:0043065	Biological Process	72%
Blast2go	negative regulation of proteolysis	GO:0045861	Biological Process	72%
Blast2go	tubulin deacetylation	GO:0090042	Biological Process	72%
Blast2go	positive regulation of signal transduction	GO:0009967	Biological Process	72%
Blast2go	polyubiquitinated misfolded protein transport	GO:0070845	Biological Process	72%
Blast2go	regulation of receptor activity	GO:0010469	Biological Process	72%
Blast2go	macroautophagy	GO:0016236	Biological Process	72%
Blast2go	cellular response to hydrogen peroxide	GO:0070301	Biological Process	72%
Blast2go	histone deacetylation	GO:0016575	Biological Process	72%
Blast2go	response to growth factor stimulus	GO:0070848	Biological Process	72%
Blast2go	misfolded or incompletely synthesized protein catabolic process	GO:0006515	Biological Process	72%
Blast2go	response to misfolded protein	GO:0051788	Biological Process	72%
Blast2go	aggresome assembly	GO:0070842	Biological Process	72%
Blast2go	peptidyl-lysine deacetylation	GO:0034983	Biological Process	72%
Blast2go	lysosome localization	GO:0032418	Biological Process	72%
Blast2go	regulation of microtubule-based process	GO:0032886	Biological Process	72%
Blast2go	Hsp90 deacetylation	GO:0070846	Biological Process	72%
Blast2go	negative regulation of protein complex disassembly	GO:0043242	Biological Process	72%
Blast2go	response to toxin	GO:0009636	Biological Process	72%
Blast2go	positive regulation of epithelial cell migration	GO:0010634	Biological Process	72%
Blast2go	polyubiquitin binding	GO:0031593	Molecular Function	72%
Blast2go	beta-catenin binding	GO:0008013	Molecular Function	72%
Blast2go	Hsp90 protein binding	GO:0051879	Molecular Function	72%
Blast2go	dynein complex binding	GO:0070840	Molecular Function	72%
Blast2go	zinc ion binding	GO:0008270	Molecular Function	72%
Blast2go	tubulin deacetylase activity	GO:0042903	Molecular Function	72%
Blast2go	histone deacetylase activity	GO:0004407	Molecular Function	72%
Blast2go	microtubule binding	GO:0008017	Molecular Function	72%
Blast2go	alpha-tubulin binding	GO:0043014	Molecular Function	72%
Blast2go	tau protein binding	GO:0048156	Molecular Function	72%
Blast2go	histone deacetylase binding	GO:0042826	Molecular Function	72%
Blast2go	aggresome	GO:0016235	Cellular Component	72%
Blast2go	caveola	GO:0005901	Cellular Component	72%
Blast2go	cell leading edge	GO:0031252	Cellular Component	72%
Blast2go	histone deacetylase complex	GO:0000118	Cellular Component	72%
Blast2go	dynein complex	GO:0030286	Cellular Component	72%
Blast2go	perinuclear region of cytoplasm	GO:0048471	Cellular Component	72%
Blast2go	microtubule	GO:0005874	Cellular Component	72%
Blast2go	nucleolus	GO:0005730	Cellular Component	72%

Source	InterPros	Term	Type	Identity
Sma3	Histone deacetylase superfamily	IPR000286	-	-
Sma3	Zinc finger, UBP-type	IPR001607	-	-
Sma3	Uncharacterised protein family Ycf19	IPR003425	-	-
Sma3	Zinc finger, C2H2	IPR007087	-	-

Full-Lengther Next Prediction

Fln status: N-terminus

Fln database: tr_plants

Fln subject: A9PBR2

Fln msg: Distance to subject end: 42 aas, atg_distance in limit (1-15): atg_distance = 12, your sequence is shorter than subject: 106 - 160

Fln protein: MSSSSASSFQEESYGSAAGWVEARTDCPHLQVLCSDLRHIPGLDTPCKRCDHPAENWICLSCKEVLCSRFINGHMLEHYENTGHCLAISYSDLSVWCFSCDAYLDT

Protein Length: 107

Fln nts: A_-_ATGTCTTCCTCTTCAGCTTCGTCTTTCCAGGAAGAAAGCTACGGAAGTGCAGCGGGCTGGGTGGAAGCTCGCACAGATTGCCCCCATCTGCAGGTTCTGTGTTCTGATCTTCGACATATACCCGGCCTTGACACTCCCTGCAAGAGGTGTGACCATCCTGCAGAAAATTGGATTTGCCTGAGCTGTAAAGAGGTTCTCTGCAGCCGCTTCATCAATGGTCACATGCTTGAGCACTATGAAAATACTGGGCATTGCTTGGCTATCAGCTACAGTGATCTTTCAGTGTGGTGCTTTTCATGCGATGCTTATTTAGATACATT

Fln Alignment:

Contig2537___AGWVEARTDCPHLQVLCSDLRHIPGLDTPCKRCDHPAENWICLSCKEVLCSRFINGHMLEHYENTGHCLAISYSDLSVWCFSCDAYLD
A9PBR2_________________SGWVEARTSCDHLASLSSDLAHIPTPDTPCNRCQHPSENWLCLSCKDVLCSRFVNKHMLQHFHQTSHCLALSYSDLSIWCFACDSYLD

Back

Biología Molecular y Biotecnología de Plantas, Facultad de Ciencias y Plataforma Andaluza de Bioinformática, Universidad de Málaga, E-29071 Málaga, Spain