SustainPineDB

All assemblies
Assembly info
Unigenes
SNPs
SSRs
Descriptions
GOs
ECs
KEGGs
InterPros
miRNAs

Assembly Name: biogeco3 v1.0

UniGene Name: biog3_v1.0_unigene2159

Length: 275 nt

This UniGene was originaly assembled in antisense
ACE File: antisense
Fasta: sense

UniGene Fasta (sense)

>biog3_v1.0_unigene2159
GGATTATCAGGAATGAACATTAAACGTGATAAAGATTCAAAACCCAAGTATAGAAGCAAATGTGTTTGACAGGACACTTAACTTGGATTGTCTCTATCTGTGCATGTGAATTTATGCTTTATCCTTCCCATGTATCTGTAGGATACACGAATGCCTAGCATCTTATCAGAAGCACATGACAATGATATGAAATTGGTAAGCTCACGCTACCTGCAAATACAGTGAAGAAGAAACGCTTCCTTACACAGTGTTACTAGTGTAGCAATGCCAATATC

Ace file of the UniGene biog3_v1.0_unigene2159 (antisense)

If you push the Download ace button, you will download an ace file of this UniGene.

To watch this ACE file you will need an ACE viewer program as Tablet:

Go to the Tablet ACE viewer Web

Annotations

Parent Assembly	Parent UniGene	Reads (related/total)
SustainPine v2.0	sp_v2.0_unigene5463	3/3

Source	Descriptions	Term	Type	Identity
AutoFact	methyltransferase / nucleic acid binding protein [Arabidopsis thaliana] gb\|AAK25997.1\|AF360287_1 unknown protein [Arabidopsis thaliana] dbj\|BAB02202.1\| unnamed protein product [Arabidopsis thaliana] gb\|AAK93720.1\| unknown protein [Arabidopsis thaliana] gb	-	-	61%
FL-Next	tr=Putative uncharacterized protein; Picea sitchensis (Sitka spruce) (Pinus sitchensis).	-	-	100%
Blast2go	trna guanosine-2 -o-methyltransferase trm11 homolog	-	-	78%

Source	ECs	Term	Type	e value	Identity
Blast2go	Transferases, Transferring one-carbon groups, Methyltransferases.	EC:2.1.1.-	-	0.0	78%

Source	KEGGs	Term	Identity
Blast2go	Ubiquinone and other terpenoid-quinone biosynthesis	00130	78%
Blast2go	Tetracycline biosynthesis	00253	78%
Blast2go	Histidine metabolism	00340	78%
Blast2go	Tyrosine metabolism	00350	78%
Blast2go	Phenylalanine metabolism	00360	78%
Blast2go	Tryptophan metabolism	00380	78%
Blast2go	Benzoxazinoid biosynthesis	00402	78%
Blast2go	Selenocompound metabolism	00450	78%
Blast2go	Biosynthesis of 12-, 14- and 16-membered macrolides	00522	78%
Blast2go	Polycyclic aromatic hydrocarbon degradation	00624	78%
Blast2go	Methane metabolism	00680	78%
Blast2go	Porphyrin and chlorophyll metabolism	00860	78%
Blast2go	Carotenoid biosynthesis	00906	78%
Blast2go	Phenylpropanoid biosynthesis	00940	78%
Blast2go	Flavonoid biosynthesis	00941	78%
Blast2go	Anthocyanin biosynthesis	00942	78%
Blast2go	Stilbenoid, diarylheptanoid and gingerol biosynthesis	00945	78%
Blast2go	Isoquinoline alkaloid biosynthesis	00950	78%
Blast2go	Insect hormone biosynthesis	00981	78%
Blast2go	Biosynthesis of type II polyketide products	01057	78%
Blast2go	Biosynthesis of alkaloids derived from shikimate pathway	01063	78%
Blast2go	Metabolic pathways	01100	78%
Blast2go	Biosynthesis of secondary metabolites	01110	78%

Source	GOs	Term	Type	Identity
Blast2go	tRNA modification	GO:0006400	Biological Process	78%
Blast2go	methylation	GO:0032259	Biological Process	78%
Blast2go	nucleic acid binding	GO:0003676	Molecular Function	78%
Blast2go	methyltransferase activity	GO:0008168	Molecular Function	78%

Source	InterPros	Term	Type	Identity
Sma3	Putative RNA methylase	IPR000241	-	-
Sma3	DNA methylase, N-6 adenine-specific, conserved site	IPR002052	-	-
Sma3	N6 adenine-specific DNA methyltransferase, N12 class	IPR002296	-	-
Sma3	tRNA guanosine-2'-O-methyltransferase, TRM11	IPR016691	-	-

Full-Lengther Next Prediction

Fln status: C-terminus

Fln database: coniferopsida.fasta

Fln subject: D5ACG8

Fln msg: your sequence is shorter than subject: 23 - 123

Fln protein: GLSGMNIKRDKDSKPKYRSKCV*

Protein Length: 24

Fln nts: GGATTATCAGGAATGAACATTAAACGTGATAAAGATTCAAAACCCAAGTATAGAAGCAAATGTGTTTGA___CAGGACACTTAACTTGGATTGTCTCTATCTGTGCATGTGAATTTATGCTTTATCCTTCCCATGTATCTGTAGGATACACGAATGCCTAGCATCTTATCAGAAGCACATGACAATGATATGAAATTGGTAAGCTCACGCTACCTGCAAATACAGTGAAGAAGAAACGCTTCCTTACACAGTGTTACTAGTGTAGCAATGCCAATATC

Fln Alignment:

Contig2159___GLSGMNIKRDKDSKPKYRSKCV
D5ACG8_________________GLSGMNIKRDKDSKPKYRSKCV

SNPs (tot: 2)

Position	A %	C %	G %	T %	Probability
87	25	75			0.996473
90	75		25		0.996473

Back

Biología Molecular y Biotecnología de Plantas, Facultad de Ciencias y Plataforma Andaluza de Bioinformática, Universidad de Málaga, E-29071 Málaga, Spain