Fln status:
Putative N-terminus
Fln database:
coniferopsida.fasta
Fln subject:
D5AED5
Fln msg:
ERROR#3, very serious frame error, Warning!, your query overlaps and the subject is separated, Distance to subject end: 196 aas, atg_distance in limit (1-15): atg_distance = 5, W2: There is no M at the beginning, your sequence is shorter than subject: 54 - 274
Test code:
0
Test Code was used to find complete genes when there was not found a reliable orthologue.
The best ORF (Open Reading Frame) is shown, and only ORFs > 200pb were analyzed.
Your ORF will be more reliable if a stop codon was found before the start codon.
A Test Code value > 0.95 means the ORF is probably coding.
A Test Code value < 0.74 means the ORF is probably non-coding.
Test Code values in between 0.74 and 0.95 mean it is uncertain whether the ORF is coding or not.
Fln protein:
TPLHLLFLLLASSAALASANFYNDVxxxxxxxGCGIQSKQEYLFAKIDIQIKLV
Protein Length:
55
Fln nts:
ACACCTCTTCACCTCCTCTTTCTTTTATTGGCCTCCTCGGCAGCTCTTGCTTCTGCAAATTTCTACAATGATGTCxxxxxxxxxxxxxxxxxxxxxGGTTGTGGTATTCAATCCAAGCAAGAGTATCTATTTGCCAAGATTGATATCCAAATCAAGTTGGTACC
Fln Alignment: