Fln status:
Putative C-terminus
Fln database:
coniferopsida.fasta
Fln subject:
Q3ZDJ2
Fln msg:
STOP codon was not found. Distance to subject end: 0 aas, your sequence is shorter than subject: 14 - 82
Test code:
0
Test Code was used to find complete genes when there was not found a reliable orthologue.
The best ORF (Open Reading Frame) is shown, and only ORFs > 200pb were analyzed.
Your ORF will be more reliable if a stop codon was found before the start codon.
A Test Code value > 0.95 means the ORF is probably coding.
A Test Code value < 0.74 means the ORF is probably non-coding.
Test Code values in between 0.74 and 0.95 mean it is uncertain whether the ORF is coding or not.
Fln protein:
CKCGSNCTCDPCNC
Protein Length:
15
Fln nts:
TGCAAGTGTGGATCCAACTGTACCTGCGATCCTTGCAATTGCAA
Fln Alignment: