UniGene Name: sp_v3.0_unigene195468
Length: 69 nt
If you push the Download ace button, you will download an ace file of this UniGene. To watch this ACE file you will need an ACE viewer program as Tablet: Go to the Tablet ACE viewer Web
Fln status: Internal
Fln database: coniferopsida.fasta
Fln subject: A5JYF2
Fln msg: Distance to subject end: 104 aas, your sequence is shorter than subject: 22 - 526
Fln protein: GHFWGFGERLDATDITSENERK Protein Length: 23
Fln nts: CGGCCATTTTTGGGGATTCGGTGAGAGACTAGATGCAACTGACATCACCTCTGAAAATGAACGAAAGGC
Fln Alignment:
AllPine_b_c35131___GHFWGFGERLDATDITSENERKA5JYF2________________GHFWGFGERLDATDITSENERK
Biología Molecular y Biotecnología de Plantas, Facultad de Ciencias y Plataforma Andaluza de Bioinformática, Universidad de Málaga, E-29071 Málaga, Spain