SustainPineDB

All assemblies
Assembly info
Unigenes
SNPs
SSRs
Descriptions
GOs
ECs
KEGGs
InterPros
miRNAs

Assembly Name: SustainPine v3.0

UniGene Name: sp_v3.0_unigene167494

Length: 87 nt

UniGene Fasta

>sp_v3.0_unigene167494
CAGGTCTTAAGCGGTGTGGGAAGAGCTGTAGATTACGTTGGATGAATTATCTTCGTCCCAATATTAAACGCGGAAACATTTCCCCCG

Ace file of the UniGene sp_v3.0_unigene167494

If you push the Download ace button, you will download an ace file of this UniGene.

To watch this ACE file you will need an ACE viewer program as Tablet:

Go to the Tablet ACE viewer Web

Annotations

Source	Descriptions	Term	Type	e value	Identity
AutoFact	Unassigned protein	-	-	0.0	-
FL-Next	tr=MYB-like protein; Taxus globosa.	-	-	0.0	92%
Sma3	R2r3-myb transcription factor, putative	-	-	7.209e-17	-

Source	Gene names
Sma3	ATR1; At1g06180; At2g31180; At2g47460; At3g62610; At5g14750; At5g35550; At5g57620; At5g60890; AtMYB84; C; C1; C1-B73; C1-I; DcMYB3-1; DcMYB3-2; DcMYB5; F26K9_40; F9P14.4; FcMYB251; FcMYB303A1; FcMYB303A2; FcMYB558; GSVIVT00002010001; GSVIVT00009522001; GS

Source	GOs	Term	Type	Identity
Sma3	nucleus	GO:0005634	Cellular Component	-
Sma3	DNA binding	GO:0003677	Molecular Function	-
Sma3	protein binding	GO:0005515	Molecular Function	-
Sma3	ATP binding	GO:0005524	Molecular Function	-
Sma3	transcription activator activity	GO:0016563	Molecular Function	-
Sma3	transcription regulator activity	GO:0030528	Molecular Function	-
Sma3	tryptophan biosynthetic process	GO:0000162	Biological Process	-
Sma3	defense response to insect	GO:0002213	Biological Process	-
Sma3	regulation of transcription, DNA-dependent	GO:0006355	Biological Process	-
Sma3	multicellular organismal development	GO:0007275	Biological Process	-
Sma3	response to salt stress	GO:0009651	Biological Process	-
Sma3	response to ethylene stimulus	GO:0009723	Biological Process	-
Sma3	response to auxin stimulus	GO:0009733	Biological Process	-
Sma3	response to abscisic acid stimulus	GO:0009737	Biological Process	-
Sma3	response to gibberellin stimulus	GO:0009739	Biological Process	-
Sma3	response to salicylic acid stimulus	GO:0009751	Biological Process	-
Sma3	response to jasmonic acid stimulus	GO:0009753	Biological Process	-
Sma3	indole glucosinolate biosynthetic process	GO:0009759	Biological Process	-
Sma3	flavonoid biosynthetic process	GO:0009813	Biological Process	-
Sma3	proanthocyanidin biosynthetic process	GO:0010023	Biological Process	-
Sma3	cellular response to sulfur starvation	GO:0010438	Biological Process	-
Sma3	cell fate commitment	GO:0045165	Biological Process	-
Sma3		GO:0045449	Biological Process	-

Source	InterPros	Term	Type	Identity
Sma3	SANT/Myb domain	IPR001005	-	-
Sma3	DNA methylase, N-6 adenine-specific, conserved site	IPR002052	-	-
Sma3		IPR012287	-	-
Sma3		IPR014778	-	-
Sma3	Myb transcription factor	IPR015495	-	-
Sma3	Myb-like domain	IPR017877	-	-
Sma3	Myb domain, DNA-binding	IPR017930	-	-

Source	Species	ID	Description	e value	Identity
ATG	Arabidoptis thaliana	AT5G35550.1	TT2, ATMYB123, MYB123, ATTT2 Duplicated homeodomain-like superfamily protein chr5:13726807-13727729 FORWARD LENGTH=258	2.0e-12	92%
RefSeq	Arabidopsis thaliana	NP_198405.1	transcription factor TT2 [Arabidopsis thaliana]	2.0e-12	92%
RefSeq	Populus trichocarpa	XP_002304289.1	predicted protein [Populus trichocarpa]	1.0e-13	96%

Full-Lengther Next Prediction

Fln status: Internal

Fln database: coniferopsida.fasta

Fln subject: F8TJT1

Fln msg: Distance to subject end: 177 aas, your sequence is shorter than subject: 28 - 250

Fln protein: GLKRCGKSCRLRWMNYLRPNIKRGNISP

Protein Length: 29

Fln nts: CAGGTCTTAAGCGGTGTGGGAAGAGCTGTAGATTACGTTGGATGAATTATCTTCGTCCCAATATTAAACGCGGAAACATTTCCCCCG

Fln Alignment:

HIF1XHV01AJM86___GLKRCGKSCRLRWMNYLRPNIKRGNIS
F8TJT1________________GLKRCGKSCRLRWLNYLRPDIKRGNIS

Back

Biología Molecular y Biotecnología de Plantas, Facultad de Ciencias y Plataforma Andaluza de Bioinformática, Universidad de Málaga, E-29071 Málaga, Spain