UniGene Name: sp_v3.0_unigene115277
Length: 91 nt
If you push the Download ace button, you will download an ace file of this UniGene. To watch this ACE file you will need an ACE viewer program as Tablet: Go to the Tablet ACE viewer Web
Fln status: C-terminus
Fln database: coniferopsida.fasta
Fln subject: D5AAH8
Fln msg: your sequence is shorter than subject: 26 - 210
Fln protein: REIIVRDANRFHHFRDGSCSCRDFW* Protein Length: 27
Fln nts: GCGAGAAATAATTGTTAGGGATGCAAATCGTTTCCACCATTTCAGAGATGGTTCCTGTTCATGCAGAGATTTTTGGTGA___AACACGACGATC
Fln Alignment:
AllPine_a_c49930___REIIVRDANRFHHFRDGSCSCRDFWD5AAH8________________REIVVRDANRFHHFKDGLCSCGDYW
Biología Molecular y Biotecnología de Plantas, Facultad de Ciencias y Plataforma Andaluza de Bioinformática, Universidad de Málaga, E-29071 Málaga, Spain