UniGene Name: sp_v3.0_unigene5113
Length:
234 nt
>sp_v3.0_unigene5113
AATGTCTAAACCTCCTCCTCCACCGAGACCAGAACCTCAGCCTAAACCTCCACCTCCACCGAGACCAGAACCTCCGCCTAAACCACCACCTCCGCCCAGGACCGGGACCTCCTCCTAACGGCTCTGCAGCGGACAGCTCCAGCAAGCGGAAACAGCTCGTTCTCTGTCAGGCTCGGCTCTTAACAAGAGCTCTCTTCCTCTTCACAATGGCGGGAGGATCTTGCTCGTCCGGCT |
If you push the Download ace button, you will download an ace file of this UniGene.
To watch this ACE file you will need an ACE viewer program as Tablet:
Go to the Tablet ACE viewer Web
| Source |
Gene names |
| Sma3 |
At2g32690; At3g20470; GRP-1; Os07g0440100; OsI_26163; OsJ_24411; P0035G02.7; P0443H10.27; glycine-rich protein/ atGRP; |
Fln status:
coding
Fln database:
testcode
Fln subject:
Fln msg:
Test code:
1
Test Code was used to find complete genes when there was not found a reliable orthologue.
The best ORF (Open Reading Frame) is shown, and only ORFs > 200pb were analyzed.
Your ORF will be more reliable if a stop codon was found before the start codon.
A Test Code value > 0.95 means the ORF is probably coding.
A Test Code value < 0.74 means the ORF is probably non-coding.
Test Code values in between 0.74 and 0.95 mean it is uncertain whether the ORF is coding or not.
Back
UniGene Fasta
