UniGene Name: sp_v3.0_unigene210487
Length: 41 nt
If you push the Download ace button, you will download an ace file of this UniGene. To watch this ACE file you will need an ACE viewer program as Tablet: Go to the Tablet ACE viewer Web
Fln status: Putative C-terminus
Fln database: coniferopsida.fasta
Fln subject: A9NL88
Fln msg: STOP codon was not found. Distance to subject end: 3 aas, your sequence is shorter than subject: 13 - 60
Fln protein: DCKCGPNCQCGTC Protein Length: 14
Fln nts: GACTGCAAGTGCGGCCCCAACTGCCAGTGTGGTACTTGCAG
Fln Alignment:
Hyp_Euler_1260___DCKCGPNCQCGTCA9NL88________________DCKCGPNCQCGTC
Biología Molecular y Biotecnología de Plantas, Facultad de Ciencias y Plataforma Andaluza de Bioinformática, Universidad de Málaga, E-29071 Málaga, Spain