UniGene Name: sp_v3.0_unigene206467
Length: 157 nt
If you push the Download ace button, you will download an ace file of this UniGene. To watch this ACE file you will need an ACE viewer program as Tablet: Go to the Tablet ACE viewer Web
Fln status: N-terminus
Fln database: coniferopsida.fasta
Fln subject: A9NN19
Fln msg: Distance to subject end: 137 aas, your sequence is shorter than subject: 23 - 160
Fln protein: MAEQTERAFLKQPKVFLSSKTSG Protein Length: 24
Fln nts: ATTAAATAAGGAAGGCTTCTATTTACTGACCTTTTTTCACAAGCAGGGGAGGGAGCGGCGGCGGCGGGAGTCTCGATTTTCAGCAGCC_-_ATGGCAGAACAGACTGAGAGAGCTTTTCTAAAGCAACCAAAAGTCTTTCTCAGTTCCAAGACGTCTGGG
Fln Alignment:
AllPine_b_rep_c65694___MAEQTERAFLKQPKVFLSSKTSGA9NN19________________MAEQTERAFLKQPKVFLSSKKSG
Biología Molecular y Biotecnología de Plantas, Facultad de Ciencias y Plataforma Andaluza de Bioinformática, Universidad de Málaga, E-29071 Málaga, Spain