SustainPineDB

All assemblies
Assembly info
Unigenes
SNPs
SSRs
Descriptions
GOs
ECs
KEGGs
InterPros
miRNAs

Assembly Name: biogeco2 v2.0

UniGene Name: biog2_v2.0_unigene9721

Length: 267 nt

UniGene Fasta

>biog2_v2.0_unigene9721
CTGGGAAGATGGTGAAGAAGAGTGCAAATGATGTCTCACAACCAGGCAGACATGTTGAGAAAATTGGAGAGTCTGCAGAATCCCTTCTTTTTTAATACAGGTAATATTGATGCCAATGCAGACATTGAAGAAGAAAGTTCTTCTCGCAGCTGGTCTTCTCCAAGATAGAAGCCCATTTGCTGGATTTCTCTTCAACCGGTATTGCAATGCTATTGGTACTAGATGATCACATTGGCCTTCGTCTTATCCAACAAGAAGCATCTGATG

Ace file of the UniGene biog2_v2.0_unigene9721

If you push the Download ace button, you will download an ace file of this UniGene.

To watch this ACE file you will need an ACE viewer program as Tablet:

Go to the Tablet ACE viewer Web

Annotations

Parent Assembly	Parent UniGene	Reads (related/total)
SustainPine v2.0	sp_v2.0_unigene5264	3/3

Source	Descriptions	Term	Type	Identity
AutoFact	putative helicase [Arabidopsis thaliana]	-	-	62%
FL-Next	tr=Putative uncharacterized protein; Picea sitchensis (Sitka spruce) (Pinus sitchensis).	-	-	70%
Blast2go	dna helicase ino80-like	-	-	74%

Source	GOs	Term	Type	Identity
Blast2go	positive regulation of DNA repair	GO:0045739	Biological Process	74%
Blast2go	regulation of transcription, DNA-dependent	GO:0006355	Biological Process	74%
Blast2go	somatic cell DNA recombination	GO:0016444	Biological Process	74%
Blast2go	DNA binding	GO:0003677	Molecular Function	74%
Blast2go	ATP binding	GO:0005524	Molecular Function	74%
Blast2go	transferase activity	GO:0016740	Molecular Function	74%
Blast2go	helicase activity	GO:0004386	Molecular Function	74%

Source	InterPros	Term	Type	Identity
Sma3	ATPase, F1/V1/A1 complex, alpha/beta subunit, nucleotide-binding domain	IPR000194	-	-
Sma3	Peptidase S8/S53, subtilisin/kexin/sedolisin	IPR000209	-	-
Sma3	SNF2-related	IPR000330	-	-
Sma3	HEAT	IPR000357	-	-
Sma3	Chromo domain/shadow	IPR000953	-	-
Sma3	SANT/Myb domain	IPR001005	-	-
Sma3	Bromodomain	IPR001487	-	-
Sma3	Helicase, C-terminal	IPR001650	-	-
Sma3	Zinc finger, RING-type	IPR001841	-	-
Sma3	Zinc finger, PHD-type	IPR001965	-	-
Sma3	DNA/RNA helicase, ATP-dependent, DEAH-box type, conserved site	IPR002464	-	-
Sma3	2-oxo acid dehydrogenase, lipoyl-binding site	IPR003016	-	-
Sma3	FY-rich, N-terminal	IPR003888	-	-
Sma3	FY-rich, C-terminal	IPR003889	-	-
Sma3	HSA	IPR006562	-	-
Sma3	Inorganic pyrophosphatase	IPR008162	-	-
Sma3	Agenet	IPR008395	-	-
Sma3	Domain of unknown function DUF1086	IPR009462	-	-
Sma3	Domain of unknown function DUF1087	IPR009463	-	-
Sma3	Armadillo-like helical	IPR011989	-	-
Sma3		IPR012287	-	-
Sma3	Vps54-like	IPR012501	-	-
Sma3	HAS subgroup	IPR013999	-	-
Sma3	Helicase, superfamily 1/2, ATP-binding domain	IPR014001	-	-
Sma3	Helicase/SANT-associated, DNA binding	IPR014012	-	-
Sma3		IPR014021	-	-
Sma3		IPR014778	-	-
Sma3	Glutamine-Leucine-Glutamine, QLQ	IPR014978	-	-
Sma3	ATPase, nucleosome remodelling ISWI, HAND domain	IPR015194	-	-
Sma3	SLIDE domain	IPR015195	-	-
Sma3	DNA ligase, ATP-dependent, conserved site	IPR016059	-	-
Sma3	Aldehyde dehydrogenase, conserved site	IPR016160	-	-
Sma3	Myb-like domain	IPR017877	-	-
Sma3	SANT domain	IPR017884	-	-
Sma3	Zinc finger, RING-type, conserved site	IPR017907	-	-
Sma3	AT hook, DNA-binding motif	IPR017956	-	-
Sma3	EF-Hand 1, calcium-binding site	IPR018247	-	-
Sma3	Bromodomain, conserved site	IPR018359	-	-
Sma3	Chaperonin Cpn60, conserved site	IPR018370	-	-
Sma3	Isocitrate lyase/phosphorylmutase, conserved site	IPR018523	-	-
Sma3	WD40 repeat, conserved site	IPR019775	-	-

Full-Lengther Next Prediction

Fln status: C-terminus

Fln database: coniferopsida.fasta

Fln subject: A9NZB1

Fln msg: Overlapping hits, possible frame ERROR between 92 and 67, your sequence is shorter than subject: 56 - 154

Fln protein: GKMVKKSANDVSQPGRHVEKIxxxxxxxxxxNTGNIDANADIEEESSSRSWSSPR*

Protein Length: 57

Fln nts: CTGGGAAGATGGTGAAGAAGAGTGCAAATGATGTCTCACAACCAGGCAGACATGTTGAGAAAATTxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxAATACAGGTAATATTGATGCCAATGCAGACATTGAAGAAGAAAGTTCTTCTCGCAGCTGGTCTTCTCCAAGATAGAAGCCCATTTGCTGGATTTCTCTTCAACCGGTATTGCAATGCTATTGGTACTAGATGATCACATTGGCCTTCGTCTTATCCAACAAGAAGCATCTGATG

Fln Alignment:

biogeco2_mira_c5467___GKMVKKSANDVSQPGRHVEKIGxxxxxxxxFNTGNIDANADIXXXXXXXXXXXPR
A9NZB1_________________GKRMKKSANDGSQPGRPAEKVAxxxxxxxxVNTVNIDANVDIEEENSSRSWSSPR

Back

Biología Molecular y Biotecnología de Plantas, Facultad de Ciencias y Plataforma Andaluza de Bioinformática, Universidad de Málaga, E-29071 Málaga, Spain