SustainPineDB

All assemblies
Assembly info
Unigenes
SNPs
SSRs
Descriptions
GOs
ECs
KEGGs
InterPros
miRNAs

Assembly Name: biogeco3 v1.0

UniGene Name: biog3_v1.0_unigene26270

Length: 299 nt

This UniGene was originaly assembled in antisense
ACE File: antisense
Fasta: sense

UniGene Fasta (sense)

>biog3_v1.0_unigene26270
AATGTCAATGCCTTTCTTTCTGACTTTGGTCTAGCTAGGCTTCTTGGAGCCTCTGAAACCCATGCAACAACTGATGTAGCAGGGACATTTGGGTACCTTGCTCCAGAGTATGCTATGACATGCCGAGTCTCAGATAAGGCAGATGTTTACAGCTATGGAGTGGTGCTGCTGGAATTACTTTCTGGCAAAAAGGCTTTAGATCCCTCATTTTCCAGCTATGGTAATGGATTCAACATTGTTGCCTGGTCATGTATGCTTCTTCGAGAAGACAGAGCACGTGAGCTTTACACCGAAGGTTT

Ace file of the UniGene biog3_v1.0_unigene26270 (antisense)

If you push the Download ace button, you will download an ace file of this UniGene.

To watch this ACE file you will need an ACE viewer program as Tablet:

Go to the Tablet ACE viewer Web

Annotations

Parent Assembly	Parent UniGene	Reads (related/total)
SustainPine v2.0	sp_v2.0_unigene3228	2/2

Source	Descriptions	Term	Type	Identity
AutoFact	LRR receptor-like serine/threonine-protein kinase RPK2 [Arabidopsis thaliana] sp\|Q9S7I6.1\|RPK2_ARATH RecName: Full=LRR receptor-like serine/threonine-protein kinase RPK2; AltName: Full=Protein TOADSTOOL 2; AltName: Full=Receptor-like protein kinase 2; Fla	-	-	67%
FL-Next	tr=Putative uncharacterized protein; Picea sitchensis (Sitka spruce) (Pinus sitchensis).	-	-	80%
Blast2go	lrr receptor-like serine threonine-protein kinase rpk2-like	-	-	81%

Source	ECs	Term	Type	e value	Identity
Blast2go	Transferases, Transferring phosphorous-containing groups, Protein-serine/threonine kinases.	EC:2.7.11.-	-	0.0	81%

Source	GOs	Term	Type	Identity
Blast2go	protein phosphorylation	GO:0006468	Biological Process	81%
Blast2go	radial axis specification	GO:0009945	Biological Process	81%
Blast2go	longitudinal axis specification	GO:0009942	Biological Process	81%
Blast2go	response to water deprivation	GO:0009414	Biological Process	81%
Blast2go	response to cold	GO:0009409	Biological Process	81%
Blast2go	protein homooligomerization	GO:0051260	Biological Process	81%
Blast2go	transmembrane receptor protein tyrosine kinase signaling pathway	GO:0007169	Biological Process	81%
Blast2go	embryonic meristem development	GO:0048508	Biological Process	81%
Blast2go	meristem maintenance	GO:0010073	Biological Process	81%
Blast2go	lignin metabolic process	GO:0009808	Biological Process	81%
Blast2go	pollen maturation	GO:0010152	Biological Process	81%
Blast2go	anther development	GO:0048653	Biological Process	81%
Blast2go	pollen germination	GO:0009846	Biological Process	81%
Blast2go	protein serine/threonine kinase activity	GO:0004674	Molecular Function	81%
Blast2go	ATP binding	GO:0005524	Molecular Function	81%
Blast2go	mitochondrion	GO:0005739	Cellular Component	81%
Blast2go	integral to membrane	GO:0016021	Cellular Component	81%
Blast2go	cytoplasmic membrane-bounded vesicle	GO:0016023	Cellular Component	81%
Blast2go	plasma membrane	GO:0005886	Cellular Component	81%

Source	InterPros	Term	Type	Identity
Sma3	Intradiol ring-cleavage dioxygenase, C-terminal	IPR000627	-	-
Sma3	Protein kinase, catalytic domain	IPR000719	-	-
Sma3	Epidermal growth factor-like domain	IPR000742	-	-
Sma3	S-locus glycoprotein	IPR000858	-	-
Sma3	Serine-threonine/tyrosine-protein kinase catalytic domain	IPR001245	-	-
Sma3	Bulb-type lectin domain	IPR001480	-	-
Sma3	Leucine-rich repeat	IPR001611	-	-
Sma3	Apple-like	IPR003609	-	-
Sma3	Pistil-specific extensin-like protein	IPR003882	-	-
Sma3	Epidermal growth factor-like	IPR006210	-	-
Sma3	Serine/threonine-protein kinase, active site	IPR008271	-	-
Sma3	Leucine-rich repeat 2	IPR013101	-	-
Sma3	Leucine-rich repeat-containing N-terminal, type 2	IPR013210	-	-
Sma3	PAN-2 domain	IPR013227	-	-
Sma3	SKG6/AXL2 alpha-helix transmembrane domain	IPR014805	-	-
Sma3	Protein kinase, ATP binding site	IPR017441	-	-
Sma3		IPR017442	-	-
Sma3	Homeobox, conserved site	IPR017970	-	-

Full-Lengther Next Prediction

Fln status: Internal

Fln database: coniferopsida.fasta

Fln subject: D5AB18

Fln msg: Distance to subject end: 46 aas, your sequence is shorter than subject: 99 - 212

Fln protein: NVNAFLSDFGLARLLGASETHATTDVAGTFGYLAPEYAMTCRVSDKADVYSYGVVLLELLSGKKALDPSFSSYGNGFNIVAWSCMLLREDRARELYTEG

Protein Length: 100

Fln nts: AATGTCAATGCCTTTCTTTCTGACTTTGGTCTAGCTAGGCTTCTTGGAGCCTCTGAAACCCATGCAACAACTGATGTAGCAGGGACATTTGGGTACCTTGCTCCAGAGTATGCTATGACATGCCGAGTCTCAGATAAGGCAGATGTTTACAGCTATGGAGTGGTGCTGCTGGAATTACTTTCTGGCAAAAAGGCTTTAGATCCCTCATTTTCCAGCTATGGTAATGGATTCAACATTGTTGCCTGGTCATGTATGCTTCTTCGAGAAGACAGAGCACGTGAGCTTTACACCGAAGGTTT

Fln Alignment:

biogeco3_mira_rep_c30243___NVNAFLSDFGLARLLGASETHATTDVAGTFGYLAPEYAMTCRVSDKADVYSYGVVLLELLSGKKALDPSFSSYGNGFNIVAWSCMLLREDRARELYTEG
D5AB18__________________NLNAYLSDFGLARLLEVSETHATTDVHGTFGYVAPEYAATCRVSDKADVYSYGVVFLELLSGKKSLDPSFSSYGNGFNIVSWACMLVREGREHEVFIPG

Back

Biología Molecular y Biotecnología de Plantas, Facultad de Ciencias y Plataforma Andaluza de Bioinformática, Universidad de Málaga, E-29071 Málaga, Spain