UniGene Name: biog3_v1.0_unigene20243
Length: 117 nt
If you push the Download ace button, you will download an ace file of this UniGene. To watch this ACE file you will need an ACE viewer program as Tablet: Go to the Tablet ACE viewer Web
Fln status: Internal
Fln database: coniferopsida.fasta
Fln subject: B8LL95
Fln msg: Overlapping hits, possible frame ERROR between 76 and 49, Distance to subject end: 199 aas, your sequence is shorter than subject: 39 - 1036
Fln protein: GHILLCHLFPRFDWHxxxxxxxxxxxSALSVFYPREDMV Protein Length: 40
Fln nts: TGGTCATATACTTTTATGTCATTTGTTTCCTCGGTTTGATTGGCATxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxTCTGCATTAAGTGTGTTCTATCCTAGGGAGGATATGGTG
Fln Alignment:
biogeco3_mira_c17901___GHILLCHLFPRFDWHAxxxxxxxxxESALSVFYPREDMVB8LL95__________________GHILLAHLLPRFDWHAxxxxxxxxxESALSVFYPREDMV
Biología Molecular y Biotecnología de Plantas, Facultad de Ciencias y Plataforma Andaluza de Bioinformática, Universidad de Málaga, E-29071 Málaga, Spain